FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632816_at:

>probe:Drosophila_2:1632816_at:70:73; Interrogation_Position=1166; Antisense; AGGACCCTCGTTCCGGATTAATGAG
>probe:Drosophila_2:1632816_at:382:229; Interrogation_Position=1185; Antisense; AATGAGAACTCTCGGCGCGAAAACA
>probe:Drosophila_2:1632816_at:293:45; Interrogation_Position=1209; Antisense; ATCGCCATCGCTTTGGCCGAAAGGG
>probe:Drosophila_2:1632816_at:650:167; Interrogation_Position=1261; Antisense; AAATGGCTCTGGATACGGCGCGTCG
>probe:Drosophila_2:1632816_at:512:491; Interrogation_Position=1285; Antisense; GTAACATTGGCTCACCACTGATACG
>probe:Drosophila_2:1632816_at:122:123; Interrogation_Position=1346; Antisense; AGCGCAGCTACTGGCCACGGGTAAG
>probe:Drosophila_2:1632816_at:435:437; Interrogation_Position=1454; Antisense; GAGGAGCACCAATACGCCAATACTG
>probe:Drosophila_2:1632816_at:615:263; Interrogation_Position=1497; Antisense; CAGCAGGCCAAGATTAGCACTCCGG
>probe:Drosophila_2:1632816_at:158:113; Interrogation_Position=1512; Antisense; AGCACTCCGGCTAAGAACGTTACCA
>probe:Drosophila_2:1632816_at:187:3; Interrogation_Position=1536; Antisense; ATTGATACGGGATCCACGCTCACGG
>probe:Drosophila_2:1632816_at:644:215; Interrogation_Position=1572; Antisense; AAGATACCCACTAAACGACGCACTG
>probe:Drosophila_2:1632816_at:303:355; Interrogation_Position=1591; Antisense; GCACTGCAGCCGATTTCTTTTAGTA
>probe:Drosophila_2:1632816_at:195:707; Interrogation_Position=1623; Antisense; TTACCCATAACCCAGCTACATTATT
>probe:Drosophila_2:1632816_at:626:85; Interrogation_Position=1680; Antisense; AGTCCCACAGTGTTGTTACGAATTG

Paste this into a BLAST search page for me
AGGACCCTCGTTCCGGATTAATGAGAATGAGAACTCTCGGCGCGAAAACAATCGCCATCGCTTTGGCCGAAAGGGAAATGGCTCTGGATACGGCGCGTCGGTAACATTGGCTCACCACTGATACGAGCGCAGCTACTGGCCACGGGTAAGGAGGAGCACCAATACGCCAATACTGCAGCAGGCCAAGATTAGCACTCCGGAGCACTCCGGCTAAGAACGTTACCAATTGATACGGGATCCACGCTCACGGAAGATACCCACTAAACGACGCACTGGCACTGCAGCCGATTTCTTTTAGTATTACCCATAACCCAGCTACATTATTAGTCCCACAGTGTTGTTACGAATTG

Full Affymetrix probeset data:

Annotations for 1632816_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720