Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632817_at:

>probe:Drosophila_2:1632817_at:557:105; Interrogation_Position=1202; Antisense; AGAAACGTTGTCAGCTGGTCCAGCA
>probe:Drosophila_2:1632817_at:440:591; Interrogation_Position=1217; Antisense; TGGTCCAGCAGGATCCTTCCAAGAT
>probe:Drosophila_2:1632817_at:634:437; Interrogation_Position=1279; Antisense; GAGGACAGTGGTTGTTGCCCCAGCA
>probe:Drosophila_2:1632817_at:135:351; Interrogation_Position=1301; Antisense; GCAGAAGCCAAATTTGTGCCGCCAA
>probe:Drosophila_2:1632817_at:577:213; Interrogation_Position=1324; Antisense; AAGAGCACCCACAACGTTGAGCTGC
>probe:Drosophila_2:1632817_at:702:467; Interrogation_Position=1339; Antisense; GTTGAGCTGCACTTCTTCGTGAAGA
>probe:Drosophila_2:1632817_at:381:379; Interrogation_Position=1389; Antisense; GAAGCGAACCTTTGTGAACCACACG
>probe:Drosophila_2:1632817_at:689:431; Interrogation_Position=1414; Antisense; GAGTGCCACTGCATCGAACGATCGA
>probe:Drosophila_2:1632817_at:66:509; Interrogation_Position=1483; Antisense; GTGCGGGCCACCATACTGAGTTGCA
>probe:Drosophila_2:1632817_at:201:723; Interrogation_Position=1503; Antisense; TTGCACCTGTCCGAAGAGCTTTGAG
>probe:Drosophila_2:1632817_at:625:419; Interrogation_Position=1609; Antisense; GAGCACTTTGCCATGAACGATCGCA
>probe:Drosophila_2:1632817_at:236:203; Interrogation_Position=1657; Antisense; AAGCCGCCCACGTGTGAGTTTGGAT
>probe:Drosophila_2:1632817_at:483:489; Interrogation_Position=1683; Antisense; GTACATGGACAAACACGGTCGCTGT
>probe:Drosophila_2:1632817_at:127:315; Interrogation_Position=1725; Antisense; GCCATCCTACAATGCCATGTCATAA

Paste this into a BLAST search page for me
AGAAACGTTGTCAGCTGGTCCAGCATGGTCCAGCAGGATCCTTCCAAGATGAGGACAGTGGTTGTTGCCCCAGCAGCAGAAGCCAAATTTGTGCCGCCAAAAGAGCACCCACAACGTTGAGCTGCGTTGAGCTGCACTTCTTCGTGAAGAGAAGCGAACCTTTGTGAACCACACGGAGTGCCACTGCATCGAACGATCGAGTGCGGGCCACCATACTGAGTTGCATTGCACCTGTCCGAAGAGCTTTGAGGAGCACTTTGCCATGAACGATCGCAAAGCCGCCCACGTGTGAGTTTGGATGTACATGGACAAACACGGTCGCTGTGCCATCCTACAATGCCATGTCATAA

Full Affymetrix probeset data:

Annotations for 1632817_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime