FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632818_at:

>probe:Drosophila_2:1632818_at:120:549; Interrogation_Position=1087; Antisense; GGAGGACCTGCTAAAGCGTCTATGT
>probe:Drosophila_2:1632818_at:491:327; Interrogation_Position=1102; Antisense; GCGTCTATGTACCACGGATACTACT
>probe:Drosophila_2:1632818_at:12:545; Interrogation_Position=1117; Antisense; GGATACTACTACCTATGGCATACAT
>probe:Drosophila_2:1632818_at:390:99; Interrogation_Position=1171; Antisense; AGAGTTCCTGGACGCATTTCGTGGT
>probe:Drosophila_2:1632818_at:126:19; Interrogation_Position=1186; Antisense; ATTTCGTGGTCTCTACAGCGCAGAT
>probe:Drosophila_2:1632818_at:253:445; Interrogation_Position=1208; Antisense; GATGAGCTAGCGCAGTTACCTACAA
>probe:Drosophila_2:1632818_at:232:475; Interrogation_Position=1222; Antisense; GTTACCTACAAACGTGTGCTATCCC
>probe:Drosophila_2:1632818_at:457:509; Interrogation_Position=1237; Antisense; GTGCTATCCCACTGTTCATGTTTAC
>probe:Drosophila_2:1632818_at:39:469; Interrogation_Position=1250; Antisense; GTTCATGTTTACTCCTTTGCCAAGG
>probe:Drosophila_2:1632818_at:175:415; Interrogation_Position=1323; Antisense; GAGCCAGCCTGGACGAAAACCTGCT
>probe:Drosophila_2:1632818_at:303:75; Interrogation_Position=1476; Antisense; AGGAGCTGGAGGTCGCCACCAAAGT
>probe:Drosophila_2:1632818_at:645:121; Interrogation_Position=948; Antisense; AGCGATGCCATGTCCTGGCCAATGA
>probe:Drosophila_2:1632818_at:691:55; Interrogation_Position=969; Antisense; ATGACCTGAACCCTGAGAGTTTTCG
>probe:Drosophila_2:1632818_at:346:101; Interrogation_Position=984; Antisense; AGAGTTTTCGTTGGCTCCAGCATAA

Paste this into a BLAST search page for me
GGAGGACCTGCTAAAGCGTCTATGTGCGTCTATGTACCACGGATACTACTGGATACTACTACCTATGGCATACATAGAGTTCCTGGACGCATTTCGTGGTATTTCGTGGTCTCTACAGCGCAGATGATGAGCTAGCGCAGTTACCTACAAGTTACCTACAAACGTGTGCTATCCCGTGCTATCCCACTGTTCATGTTTACGTTCATGTTTACTCCTTTGCCAAGGGAGCCAGCCTGGACGAAAACCTGCTAGGAGCTGGAGGTCGCCACCAAAGTAGCGATGCCATGTCCTGGCCAATGAATGACCTGAACCCTGAGAGTTTTCGAGAGTTTTCGTTGGCTCCAGCATAA

Full Affymetrix probeset data:

Annotations for 1632818_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720