Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632819_at:

>probe:Drosophila_2:1632819_at:692:319; Interrogation_Position=6475; Antisense; GCCGCGATACTTTTTCATTTCTATT
>probe:Drosophila_2:1632819_at:192:479; Interrogation_Position=6506; Antisense; GTTTAGTTCGCATTAAGTTTATTCA
>probe:Drosophila_2:1632819_at:510:713; Interrogation_Position=6527; Antisense; TTCATTTATCTTATCTATCCACGCC
>probe:Drosophila_2:1632819_at:585:277; Interrogation_Position=6541; Antisense; CTATCCACGCCTAGAAGAGCATACT
>probe:Drosophila_2:1632819_at:680:429; Interrogation_Position=6605; Antisense; GAGTTTTTCCAGAACTTGAGCACAT
>probe:Drosophila_2:1632819_at:626:419; Interrogation_Position=6622; Antisense; GAGCACATTCTAAGCGAAGGGCACA
>probe:Drosophila_2:1632819_at:650:371; Interrogation_Position=6637; Antisense; GAAGGGCACATACACAGAAAACGAA
>probe:Drosophila_2:1632819_at:320:173; Interrogation_Position=6655; Antisense; AAACGAACACCCATCTAACAACTTG
>probe:Drosophila_2:1632819_at:642:423; Interrogation_Position=6708; Antisense; GAGAAAACTCTCTGCCAGCAATCGA
>probe:Drosophila_2:1632819_at:160:381; Interrogation_Position=6731; Antisense; GAACGTAAGCGAACACAACTGTCAT
>probe:Drosophila_2:1632819_at:572:183; Interrogation_Position=6763; Antisense; AACAAATTTCGATGTACGTAGCATA
>probe:Drosophila_2:1632819_at:374:485; Interrogation_Position=6801; Antisense; GTAGTTGCAACTTCTCTAGGCTATT
>probe:Drosophila_2:1632819_at:340:19; Interrogation_Position=6867; Antisense; ATTTGTAGCTCTAAGTGAACCCAAC
>probe:Drosophila_2:1632819_at:148:245; Interrogation_Position=6907; Antisense; AATTTCACAATACATGCGTACATGC

Paste this into a BLAST search page for me
GCCGCGATACTTTTTCATTTCTATTGTTTAGTTCGCATTAAGTTTATTCATTCATTTATCTTATCTATCCACGCCCTATCCACGCCTAGAAGAGCATACTGAGTTTTTCCAGAACTTGAGCACATGAGCACATTCTAAGCGAAGGGCACAGAAGGGCACATACACAGAAAACGAAAAACGAACACCCATCTAACAACTTGGAGAAAACTCTCTGCCAGCAATCGAGAACGTAAGCGAACACAACTGTCATAACAAATTTCGATGTACGTAGCATAGTAGTTGCAACTTCTCTAGGCTATTATTTGTAGCTCTAAGTGAACCCAACAATTTCACAATACATGCGTACATGC

Full Affymetrix probeset data:

Annotations for 1632819_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime