Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632822_at:

>probe:Drosophila_2:1632822_at:726:41; Interrogation_Position=5554; Antisense; ATCGAAGCTAATTGAGGGCCTAAAC
>probe:Drosophila_2:1632822_at:166:107; Interrogation_Position=5583; Antisense; AGCAAAAATCCGGAAGCGCCTCGAG
>probe:Drosophila_2:1632822_at:560:417; Interrogation_Position=5605; Antisense; GAGCGGCATCGGAATCAACGCCTCA
>probe:Drosophila_2:1632822_at:143:301; Interrogation_Position=5623; Antisense; CGCCTCAGCCATTGGTTCGGATATG
>probe:Drosophila_2:1632822_at:728:413; Interrogation_Position=5651; Antisense; GACCAGCGAGGTGACTTCATTAAAT
>probe:Drosophila_2:1632822_at:652:435; Interrogation_Position=5694; Antisense; GAGGCTCCCAACTGGACAACTATTA
>probe:Drosophila_2:1632822_at:206:101; Interrogation_Position=5728; Antisense; AGAGGACCTATAGACGCATCCTGCC
>probe:Drosophila_2:1632822_at:312:347; Interrogation_Position=5743; Antisense; GCATCCTGCCATGATATCTCTTGAT
>probe:Drosophila_2:1632822_at:235:211; Interrogation_Position=5804; Antisense; AAGAAACTCCTTGCCTAATCAATGA
>probe:Drosophila_2:1632822_at:232:31; Interrogation_Position=5892; Antisense; ATAAGCGCTGTTCATTTCCAATCCG
>probe:Drosophila_2:1632822_at:632:235; Interrogation_Position=5911; Antisense; AATCCGATTGCATTTTTGGGTAAAG
>probe:Drosophila_2:1632822_at:299:329; Interrogation_Position=6023; Antisense; GCGTGATGCACGTATTAGTTTATTC
>probe:Drosophila_2:1632822_at:14:245; Interrogation_Position=6077; Antisense; AATTTGCTATTTTTGTTGCCAGGCT
>probe:Drosophila_2:1632822_at:531:603; Interrogation_Position=6090; Antisense; TGTTGCCAGGCTTTTATCTTAATAA

Paste this into a BLAST search page for me
ATCGAAGCTAATTGAGGGCCTAAACAGCAAAAATCCGGAAGCGCCTCGAGGAGCGGCATCGGAATCAACGCCTCACGCCTCAGCCATTGGTTCGGATATGGACCAGCGAGGTGACTTCATTAAATGAGGCTCCCAACTGGACAACTATTAAGAGGACCTATAGACGCATCCTGCCGCATCCTGCCATGATATCTCTTGATAAGAAACTCCTTGCCTAATCAATGAATAAGCGCTGTTCATTTCCAATCCGAATCCGATTGCATTTTTGGGTAAAGGCGTGATGCACGTATTAGTTTATTCAATTTGCTATTTTTGTTGCCAGGCTTGTTGCCAGGCTTTTATCTTAATAA

Full Affymetrix probeset data:

Annotations for 1632822_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime