FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632823_at:

>probe:Drosophila_2:1632823_at:526:31; Interrogation_Position=239; Antisense; ATAATGGTTCGCTTGTGGTCAGTGC
>probe:Drosophila_2:1632823_at:627:535; Interrogation_Position=255; Antisense; GGTCAGTGCGAAAAACATGGCTAAT
>probe:Drosophila_2:1632823_at:122:327; Interrogation_Position=449; Antisense; GCGATCTGAGCGATAAATTCCCACG
>probe:Drosophila_2:1632823_at:249:565; Interrogation_Position=490; Antisense; GGCAAACTGAGCAAATTGGGCACCA
>probe:Drosophila_2:1632823_at:310:247; Interrogation_Position=503; Antisense; AATTGGGCACCAAAAGCGTCGGCCT
>probe:Drosophila_2:1632823_at:129:183; Interrogation_Position=514; Antisense; AAAAGCGTCGGCCTCAAACGCGTCT
>probe:Drosophila_2:1632823_at:451:273; Interrogation_Position=540; Antisense; CTTTGGGTCCTCGAAGGGTTCGATG
>probe:Drosophila_2:1632823_at:257:471; Interrogation_Position=557; Antisense; GTTCGATGGTGGAGACGCTCGTCTT
>probe:Drosophila_2:1632823_at:16:425; Interrogation_Position=568; Antisense; GAGACGCTCGTCTTCGAGACGCCGA
>probe:Drosophila_2:1632823_at:80:301; Interrogation_Position=593; Antisense; CGCCGTTGTCGGAGCACATGGAGTC
>probe:Drosophila_2:1632823_at:4:151; Interrogation_Position=608; Antisense; ACATGGAGTCCACTTTTGGGTTCGA
>probe:Drosophila_2:1632823_at:318:149; Interrogation_Position=619; Antisense; ACTTTTGGGTTCGATGCCGCAGATA
>probe:Drosophila_2:1632823_at:117:635; Interrogation_Position=704; Antisense; TCGCCGGTGGCTACAGTGGAGACTA
>probe:Drosophila_2:1632823_at:43:543; Interrogation_Position=737; Antisense; GGACCATGGATGACAGCGGCATTGA

Paste this into a BLAST search page for me
ATAATGGTTCGCTTGTGGTCAGTGCGGTCAGTGCGAAAAACATGGCTAATGCGATCTGAGCGATAAATTCCCACGGGCAAACTGAGCAAATTGGGCACCAAATTGGGCACCAAAAGCGTCGGCCTAAAAGCGTCGGCCTCAAACGCGTCTCTTTGGGTCCTCGAAGGGTTCGATGGTTCGATGGTGGAGACGCTCGTCTTGAGACGCTCGTCTTCGAGACGCCGACGCCGTTGTCGGAGCACATGGAGTCACATGGAGTCCACTTTTGGGTTCGAACTTTTGGGTTCGATGCCGCAGATATCGCCGGTGGCTACAGTGGAGACTAGGACCATGGATGACAGCGGCATTGA

Full Affymetrix probeset data:

Annotations for 1632823_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720