FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632826_at:

>probe:Drosophila_2:1632826_at:108:241; Interrogation_Position=356; Antisense; AATAAGATATCCATCCGGCACCTGG
>probe:Drosophila_2:1632826_at:217:65; Interrogation_Position=422; Antisense; ATGGTCAGCAAACATGTCCGCCAGT
>probe:Drosophila_2:1632826_at:430:307; Interrogation_Position=459; Antisense; CCATGCAGCGCATATGCTTCGATGA
>probe:Drosophila_2:1632826_at:157:343; Interrogation_Position=474; Antisense; GCTTCGATGAGGTCATGGGCATCTA
>probe:Drosophila_2:1632826_at:321:593; Interrogation_Position=489; Antisense; TGGGCATCTACTCCAGTCTTGGCAA
>probe:Drosophila_2:1632826_at:472:497; Interrogation_Position=504; Antisense; GTCTTGGCAAGCACGGCGGCATGTT
>probe:Drosophila_2:1632826_at:705:331; Interrogation_Position=519; Antisense; GCGGCATGTTGTCTCCCAAGAAAAA
>probe:Drosophila_2:1632826_at:201:41; Interrogation_Position=548; Antisense; ATCGAGGCGGACCAGTTCGTATCCA
>probe:Drosophila_2:1632826_at:180:471; Interrogation_Position=562; Antisense; GTTCGTATCCAGTCTAAGGGTCTTT
>probe:Drosophila_2:1632826_at:707:451; Interrogation_Position=593; Antisense; GATAAGTCCGGTTGGATTCCCGCCA
>probe:Drosophila_2:1632826_at:358:105; Interrogation_Position=620; Antisense; AGACTCCGGCGCATTCTAACCAAGA
>probe:Drosophila_2:1632826_at:477:137; Interrogation_Position=675; Antisense; ACGAGCTGCTCCAGGGTAGGATCAA
>probe:Drosophila_2:1632826_at:444:159; Interrogation_Position=699; Antisense; ACAAAGACGGCTTGGTCGACTACAA
>probe:Drosophila_2:1632826_at:169:379; Interrogation_Position=724; Antisense; GAAGCTGGTTCAAGACATTATCTAT

Paste this into a BLAST search page for me
AATAAGATATCCATCCGGCACCTGGATGGTCAGCAAACATGTCCGCCAGTCCATGCAGCGCATATGCTTCGATGAGCTTCGATGAGGTCATGGGCATCTATGGGCATCTACTCCAGTCTTGGCAAGTCTTGGCAAGCACGGCGGCATGTTGCGGCATGTTGTCTCCCAAGAAAAAATCGAGGCGGACCAGTTCGTATCCAGTTCGTATCCAGTCTAAGGGTCTTTGATAAGTCCGGTTGGATTCCCGCCAAGACTCCGGCGCATTCTAACCAAGAACGAGCTGCTCCAGGGTAGGATCAAACAAAGACGGCTTGGTCGACTACAAGAAGCTGGTTCAAGACATTATCTAT

Full Affymetrix probeset data:

Annotations for 1632826_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720