Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632828_at:

>probe:Drosophila_2:1632828_at:712:579; Interrogation_Position=1823; Antisense; TGGCCACGCTGGTCATGAATCCCAT
>probe:Drosophila_2:1632828_at:356:501; Interrogation_Position=1852; Antisense; GTCGTTTATGTGATCGTGCTGGCCA
>probe:Drosophila_2:1632828_at:196:509; Interrogation_Position=1867; Antisense; GTGCTGGCCATGACATTCTACCAGT
>probe:Drosophila_2:1632828_at:242:375; Interrogation_Position=1911; Antisense; GAAGATCATGCTGAGGGCGGCCACC
>probe:Drosophila_2:1632828_at:434:545; Interrogation_Position=1944; Antisense; GGATGCCTCGGCTTATGGACTTATC
>probe:Drosophila_2:1632828_at:106:463; Interrogation_Position=1969; Antisense; GATTCCGTGATTTATGGCAACTGGC
>probe:Drosophila_2:1632828_at:165:143; Interrogation_Position=1988; Antisense; ACTGGCTGTACTTTGTCATCTGCAC
>probe:Drosophila_2:1632828_at:222:615; Interrogation_Position=2008; Antisense; TGCACGATTTTCCTGCCGCTGTGGA
>probe:Drosophila_2:1632828_at:622:595; Interrogation_Position=2027; Antisense; TGTGGATCATCTGCTGGACCTTGTC
>probe:Drosophila_2:1632828_at:414:325; Interrogation_Position=2066; Antisense; GCGACTACGCAGATTACCTGGACTT
>probe:Drosophila_2:1632828_at:227:287; Interrogation_Position=2083; Antisense; CTGGACTTCGATGAGTCGCCATCAA
>probe:Drosophila_2:1632828_at:411:385; Interrogation_Position=2152; Antisense; GAACAGCACGGATTGCCATTCACTG
>probe:Drosophila_2:1632828_at:231:711; Interrogation_Position=2170; Antisense; TTCACTGGCTACATATATCAACTGG
>probe:Drosophila_2:1632828_at:181:345; Interrogation_Position=2383; Antisense; GCATTTTCGATGTTGATTCCCAGTT

Paste this into a BLAST search page for me
TGGCCACGCTGGTCATGAATCCCATGTCGTTTATGTGATCGTGCTGGCCAGTGCTGGCCATGACATTCTACCAGTGAAGATCATGCTGAGGGCGGCCACCGGATGCCTCGGCTTATGGACTTATCGATTCCGTGATTTATGGCAACTGGCACTGGCTGTACTTTGTCATCTGCACTGCACGATTTTCCTGCCGCTGTGGATGTGGATCATCTGCTGGACCTTGTCGCGACTACGCAGATTACCTGGACTTCTGGACTTCGATGAGTCGCCATCAAGAACAGCACGGATTGCCATTCACTGTTCACTGGCTACATATATCAACTGGGCATTTTCGATGTTGATTCCCAGTT

Full Affymetrix probeset data:

Annotations for 1632828_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime