Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632829_at:

>probe:Drosophila_2:1632829_at:454:675; Interrogation_Position=1434; Antisense; TAGCAAGTCCGTGGATGAGTTCCCG
>probe:Drosophila_2:1632829_at:262:513; Interrogation_Position=1479; Antisense; GTGTAAGAGCTGTCAGTCGCTTTTC
>probe:Drosophila_2:1632829_at:163:709; Interrogation_Position=1516; Antisense; TTCAATCGCACTTGCCAAATGGCCG
>probe:Drosophila_2:1632829_at:345:169; Interrogation_Position=1552; Antisense; AAATGGTGCTGTTGCCAGCCCACGG
>probe:Drosophila_2:1632829_at:537:363; Interrogation_Position=1587; Antisense; GAATTCCCCGCATGTGAGCACAATT
>probe:Drosophila_2:1632829_at:620:569; Interrogation_Position=1617; Antisense; GGCTATTGTCCAGCGAATGAACGAA
>probe:Drosophila_2:1632829_at:108:655; Interrogation_Position=1656; Antisense; TAATCTCAGCGATCTTTGCCACAAT
>probe:Drosophila_2:1632829_at:241:209; Interrogation_Position=1703; Antisense; AAGCAGATCGCAAAACCATCCTGTC
>probe:Drosophila_2:1632829_at:283:111; Interrogation_Position=1796; Antisense; ACCCAATTTTTGAGGCCACTGTGCG
>probe:Drosophila_2:1632829_at:110:311; Interrogation_Position=1810; Antisense; GCCACTGTGCGCTGGAATAGTCGAA
>probe:Drosophila_2:1632829_at:155:559; Interrogation_Position=1823; Antisense; GGAATAGTCGAACCCAAAGGCTTCT
>probe:Drosophila_2:1632829_at:488:169; Interrogation_Position=1838; Antisense; AAAGGCTTCTTCACTTCGATGTCGA
>probe:Drosophila_2:1632829_at:443:419; Interrogation_Position=1864; Antisense; GAGCTAAGTCGATTGACCTCCTACA
>probe:Drosophila_2:1632829_at:121:91; Interrogation_Position=1954; Antisense; AGTAGGCCTAGTTAGCACTGGTTAA

Paste this into a BLAST search page for me
TAGCAAGTCCGTGGATGAGTTCCCGGTGTAAGAGCTGTCAGTCGCTTTTCTTCAATCGCACTTGCCAAATGGCCGAAATGGTGCTGTTGCCAGCCCACGGGAATTCCCCGCATGTGAGCACAATTGGCTATTGTCCAGCGAATGAACGAATAATCTCAGCGATCTTTGCCACAATAAGCAGATCGCAAAACCATCCTGTCACCCAATTTTTGAGGCCACTGTGCGGCCACTGTGCGCTGGAATAGTCGAAGGAATAGTCGAACCCAAAGGCTTCTAAAGGCTTCTTCACTTCGATGTCGAGAGCTAAGTCGATTGACCTCCTACAAGTAGGCCTAGTTAGCACTGGTTAA

Full Affymetrix probeset data:

Annotations for 1632829_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime