Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632833_at:

>probe:Drosophila_2:1632833_at:163:275; Interrogation_Position=1641; Antisense; CATTGTGGTGGGTGGCTTTATCGCC
>probe:Drosophila_2:1632833_at:372:699; Interrogation_Position=1681; Antisense; TTTATCAACTATCTGATCACCCCGT
>probe:Drosophila_2:1632833_at:561:649; Interrogation_Position=1748; Antisense; TCACCTGGCTGGGTTGGTTCAATAG
>probe:Drosophila_2:1632833_at:115:655; Interrogation_Position=1766; Antisense; TCAATAGCGCCATTAATCCCTTCAT
>probe:Drosophila_2:1632833_at:526:385; Interrogation_Position=1884; Antisense; GAACACCATGTCCATCAGGCGATAG
>probe:Drosophila_2:1632833_at:208:3; Interrogation_Position=1915; Antisense; ATTGGACTGGACTCGCCTGGAAACA
>probe:Drosophila_2:1632833_at:287:321; Interrogation_Position=1961; Antisense; GCCCTGAACAAATTTGCACGCGCAT
>probe:Drosophila_2:1632833_at:120:711; Interrogation_Position=2003; Antisense; TTCATTAACTTTAGACGCGTCGGCA
>probe:Drosophila_2:1632833_at:360:247; Interrogation_Position=2048; Antisense; AATTGCACCCACAGTCCATGTGTAA
>probe:Drosophila_2:1632833_at:227:247; Interrogation_Position=2071; Antisense; AATTGTTCTCCAGTTTCTCGTATAG
>probe:Drosophila_2:1632833_at:372:687; Interrogation_Position=2098; Antisense; TATTTCATCGTCAGGGTTTGCTTCC
>probe:Drosophila_2:1632833_at:207:481; Interrogation_Position=2113; Antisense; GTTTGCTTCCGATTCTGGATCATTT
>probe:Drosophila_2:1632833_at:469:453; Interrogation_Position=2130; Antisense; GATCATTTTGCCACTTAGGAGACGA
>probe:Drosophila_2:1632833_at:542:259; Interrogation_Position=2175; Antisense; CACTGCTTTCAGTTGACCTTTTAGA

Paste this into a BLAST search page for me
CATTGTGGTGGGTGGCTTTATCGCCTTTATCAACTATCTGATCACCCCGTTCACCTGGCTGGGTTGGTTCAATAGTCAATAGCGCCATTAATCCCTTCATGAACACCATGTCCATCAGGCGATAGATTGGACTGGACTCGCCTGGAAACAGCCCTGAACAAATTTGCACGCGCATTTCATTAACTTTAGACGCGTCGGCAAATTGCACCCACAGTCCATGTGTAAAATTGTTCTCCAGTTTCTCGTATAGTATTTCATCGTCAGGGTTTGCTTCCGTTTGCTTCCGATTCTGGATCATTTGATCATTTTGCCACTTAGGAGACGACACTGCTTTCAGTTGACCTTTTAGA

Full Affymetrix probeset data:

Annotations for 1632833_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime