Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632834_a_at:

>probe:Drosophila_2:1632834_a_at:508:107; Interrogation_Position=113; Antisense; AGAACATCCTGTCCACGTTGAAGGA
>probe:Drosophila_2:1632834_a_at:235:603; Interrogation_Position=161; Antisense; TGTTCAATAAGACGCACCGCTCCAA
>probe:Drosophila_2:1632834_a_at:455:37; Interrogation_Position=193; Antisense; ATCATTATGCTGGACGGACTCACCT
>probe:Drosophila_2:1632834_a_at:462:557; Interrogation_Position=208; Antisense; GGACTCACCTGCGTGTACAAGAGCA
>probe:Drosophila_2:1632834_a_at:536:129; Interrogation_Position=239; Antisense; ACCTCTTCTTCTACGTGATGGGCAA
>probe:Drosophila_2:1632834_a_at:727:593; Interrogation_Position=257; Antisense; TGGGCAACGCCTACGAGAACGAGCT
>probe:Drosophila_2:1632834_a_at:19:653; Interrogation_Position=299; Antisense; TCAACTGCCTCTACGATTCCATTAG
>probe:Drosophila_2:1632834_a_at:62:463; Interrogation_Position=313; Antisense; GATTCCATTAGCCTGATCCTCAAGA
>probe:Drosophila_2:1632834_a_at:103:201; Interrogation_Position=367; Antisense; AACCTGGAGATCATCATGCTGGCAT
>probe:Drosophila_2:1632834_a_at:664:451; Interrogation_Position=399; Antisense; GATCTGCGACGGAGGCATTATTCTG
>probe:Drosophila_2:1632834_a_at:99:621; Interrogation_Position=426; Antisense; TGCGGATCCCTCGTCGGTGGTGAAA
>probe:Drosophila_2:1632834_a_at:664:533; Interrogation_Position=444; Antisense; GGTGAAACGCGTTGATCTGCGCAAC
>probe:Drosophila_2:1632834_a_at:415:443; Interrogation_Position=469; Antisense; GATGACATTCCCATTGCCGAACAGA
>probe:Drosophila_2:1632834_a_at:634:45; Interrogation_Position=91; Antisense; ATCCTGGCCAAGTACTACGACAAGA

Paste this into a BLAST search page for me
AGAACATCCTGTCCACGTTGAAGGATGTTCAATAAGACGCACCGCTCCAAATCATTATGCTGGACGGACTCACCTGGACTCACCTGCGTGTACAAGAGCAACCTCTTCTTCTACGTGATGGGCAATGGGCAACGCCTACGAGAACGAGCTTCAACTGCCTCTACGATTCCATTAGGATTCCATTAGCCTGATCCTCAAGAAACCTGGAGATCATCATGCTGGCATGATCTGCGACGGAGGCATTATTCTGTGCGGATCCCTCGTCGGTGGTGAAAGGTGAAACGCGTTGATCTGCGCAACGATGACATTCCCATTGCCGAACAGAATCCTGGCCAAGTACTACGACAAGA

Full Affymetrix probeset data:

Annotations for 1632834_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime