FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632835_at:

>probe:Drosophila_2:1632835_at:262:525; Interrogation_Position=375; Antisense; GGGCAACTATGAGCAGACCTTCGTC
>probe:Drosophila_2:1632835_at:520:581; Interrogation_Position=401; Antisense; TGGCCTTACTGATGACCTTGTTGAC
>probe:Drosophila_2:1632835_at:549:341; Interrogation_Position=476; Antisense; GCTTCTGCGAGAAACCGGACTTTGT
>probe:Drosophila_2:1632835_at:646:73; Interrogation_Position=512; Antisense; AGGACACGGCTCTGAATCTGTTCAA
>probe:Drosophila_2:1632835_at:110:491; Interrogation_Position=537; Antisense; GTACAATGCACTGGGCGGTATTCTG
>probe:Drosophila_2:1632835_at:55:557; Interrogation_Position=601; Antisense; GGACGTGACTGGCAGGCTTATCCCA
>probe:Drosophila_2:1632835_at:208:11; Interrogation_Position=625; Antisense; ATTCCCAACGTGATCGGAGCACTGC
>probe:Drosophila_2:1632835_at:181:333; Interrogation_Position=648; Antisense; GCTGGGAAGCGCTCTGGGCAATATA
>probe:Drosophila_2:1632835_at:260:687; Interrogation_Position=669; Antisense; TATATACGCTTGTACGCATGTCCTC
>probe:Drosophila_2:1632835_at:23:671; Interrogation_Position=694; Antisense; TACGCCACAGCTCGAGTTTACATGA
>probe:Drosophila_2:1632835_at:347:241; Interrogation_Position=743; Antisense; AATAAAACTCTTCATTCTGCCACCA
>probe:Drosophila_2:1632835_at:513:215; Interrogation_Position=767; Antisense; AAGATTATTACGTTGCGCTGCCACT
>probe:Drosophila_2:1632835_at:604:283; Interrogation_Position=790; Antisense; CTGAAATCCACTCATCCACTAAGAA
>probe:Drosophila_2:1632835_at:523:45; Interrogation_Position=825; Antisense; ATCCCGTCTAGTCAGCAGCTTAGGA

Paste this into a BLAST search page for me
GGGCAACTATGAGCAGACCTTCGTCTGGCCTTACTGATGACCTTGTTGACGCTTCTGCGAGAAACCGGACTTTGTAGGACACGGCTCTGAATCTGTTCAAGTACAATGCACTGGGCGGTATTCTGGGACGTGACTGGCAGGCTTATCCCAATTCCCAACGTGATCGGAGCACTGCGCTGGGAAGCGCTCTGGGCAATATATATATACGCTTGTACGCATGTCCTCTACGCCACAGCTCGAGTTTACATGAAATAAAACTCTTCATTCTGCCACCAAAGATTATTACGTTGCGCTGCCACTCTGAAATCCACTCATCCACTAAGAAATCCCGTCTAGTCAGCAGCTTAGGA

Full Affymetrix probeset data:

Annotations for 1632835_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720