Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632836_at:

>probe:Drosophila_2:1632836_at:642:673; Interrogation_Position=1281; Antisense; TACCAGAACAACACAGCAGACAGCG
>probe:Drosophila_2:1632836_at:216:351; Interrogation_Position=1296; Antisense; GCAGACAGCGGCAACATGTACAGCA
>probe:Drosophila_2:1632836_at:492:377; Interrogation_Position=1421; Antisense; GAAGCGGAACCGGATCGAGAACAAC
>probe:Drosophila_2:1632836_at:577:497; Interrogation_Position=1472; Antisense; GTCATTACGATAAAGCAGCTGCCAT
>probe:Drosophila_2:1632836_at:14:337; Interrogation_Position=1489; Antisense; GCTGCCATTAGCTGGGAGCAACAAT
>probe:Drosophila_2:1632836_at:167:67; Interrogation_Position=1562; Antisense; ATGGAGGACCCCATGGCGGATACAT
>probe:Drosophila_2:1632836_at:710:453; Interrogation_Position=1580; Antisense; GATACATGATATCCGCACATACCCA
>probe:Drosophila_2:1632836_at:305:151; Interrogation_Position=1596; Antisense; ACATACCCATAAGACTGCCGCGTGG
>probe:Drosophila_2:1632836_at:464:283; Interrogation_Position=1610; Antisense; CTGCCGCGTGGCAAGCATTGAATCT
>probe:Drosophila_2:1632836_at:681:273; Interrogation_Position=1625; Antisense; CATTGAATCTGGCTAACTCTCTTGG
>probe:Drosophila_2:1632836_at:57:193; Interrogation_Position=1639; Antisense; AACTCTCTTGGCTGCCGATAAGGAC
>probe:Drosophila_2:1632836_at:20:295; Interrogation_Position=1666; Antisense; CGATAATGATAACTGTTGCTGCTGC
>probe:Drosophila_2:1632836_at:217:335; Interrogation_Position=1689; Antisense; GCTGCTGTTGCAAGAAACCAATTTT
>probe:Drosophila_2:1632836_at:95:319; Interrogation_Position=1725; Antisense; GCCGAGACCTTTACATGCTTGATAC

Paste this into a BLAST search page for me
TACCAGAACAACACAGCAGACAGCGGCAGACAGCGGCAACATGTACAGCAGAAGCGGAACCGGATCGAGAACAACGTCATTACGATAAAGCAGCTGCCATGCTGCCATTAGCTGGGAGCAACAATATGGAGGACCCCATGGCGGATACATGATACATGATATCCGCACATACCCAACATACCCATAAGACTGCCGCGTGGCTGCCGCGTGGCAAGCATTGAATCTCATTGAATCTGGCTAACTCTCTTGGAACTCTCTTGGCTGCCGATAAGGACCGATAATGATAACTGTTGCTGCTGCGCTGCTGTTGCAAGAAACCAATTTTGCCGAGACCTTTACATGCTTGATAC

Full Affymetrix probeset data:

Annotations for 1632836_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime