Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632842_at:

>probe:Drosophila_2:1632842_at:180:717; Interrogation_Position=113; Antisense; TTCGATGGTCGGAGATGCGTCTGTT
>probe:Drosophila_2:1632842_at:670:639; Interrogation_Position=121; Antisense; TCGGAGATGCGTCTGTTGTTTCTCC
>probe:Drosophila_2:1632842_at:155:305; Interrogation_Position=21; Antisense; CCTGATGCCCTCCATCATCGAGTTT
>probe:Drosophila_2:1632842_at:661:429; Interrogation_Position=40; Antisense; GAGTTTGGCGGGAAACGCTGTAATT
>probe:Drosophila_2:1632842_at:98:339; Interrogation_Position=401; Antisense; GCTAACAGAAGATGGCTCGAATTTA
>probe:Drosophila_2:1632842_at:593:537; Interrogation_Position=414; Antisense; GGCTCGAATTTATCCCAGTGCAGTT
>probe:Drosophila_2:1632842_at:2:365; Interrogation_Position=419; Antisense; GAATTTATCCCAGTGCAGTTGCGGG
>probe:Drosophila_2:1632842_at:294:173; Interrogation_Position=482; Antisense; AAAGCAGTGGGCTTGGACTGCAATT
>probe:Drosophila_2:1632842_at:350:527; Interrogation_Position=49; Antisense; GGGAAACGCTGTAATTCGTCAGATA
>probe:Drosophila_2:1632842_at:96:571; Interrogation_Position=491; Antisense; GGCTTGGACTGCAATTTCGGTGGAT
>probe:Drosophila_2:1632842_at:251:363; Interrogation_Position=501; Antisense; GCAATTTCGGTGGATAAGTGGCCAG
>probe:Drosophila_2:1632842_at:7:715; Interrogation_Position=63; Antisense; TTCGTCAGATATTCTGCCGCCCAAG
>probe:Drosophila_2:1632842_at:527:321; Interrogation_Position=81; Antisense; GCCCAAGGCGCATGCGTTGCAAAAA
>probe:Drosophila_2:1632842_at:678:623; Interrogation_Position=93; Antisense; TGCGTTGCAAAAATCCGACATTCGA

Paste this into a BLAST search page for me
TTCGATGGTCGGAGATGCGTCTGTTTCGGAGATGCGTCTGTTGTTTCTCCCCTGATGCCCTCCATCATCGAGTTTGAGTTTGGCGGGAAACGCTGTAATTGCTAACAGAAGATGGCTCGAATTTAGGCTCGAATTTATCCCAGTGCAGTTGAATTTATCCCAGTGCAGTTGCGGGAAAGCAGTGGGCTTGGACTGCAATTGGGAAACGCTGTAATTCGTCAGATAGGCTTGGACTGCAATTTCGGTGGATGCAATTTCGGTGGATAAGTGGCCAGTTCGTCAGATATTCTGCCGCCCAAGGCCCAAGGCGCATGCGTTGCAAAAATGCGTTGCAAAAATCCGACATTCGA

Full Affymetrix probeset data:

Annotations for 1632842_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime