FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632843_at:

>probe:Drosophila_2:1632843_at:602:653; Interrogation_Position=1004; Antisense; TAAGGGCCTAATGCCCACTTGGTTT
>probe:Drosophila_2:1632843_at:240:529; Interrogation_Position=1034; Antisense; GGGACCGTTCTCAGTGCTCTTTTGG
>probe:Drosophila_2:1632843_at:661:551; Interrogation_Position=1106; Antisense; GGAGCAAACTATCAATCTTACTATC
>probe:Drosophila_2:1632843_at:319:619; Interrogation_Position=655; Antisense; TGCAGGCCTTCGTGGACATCTACCG
>probe:Drosophila_2:1632843_at:93:619; Interrogation_Position=723; Antisense; TGCATGCGTGCCTGCCTGATGACGA
>probe:Drosophila_2:1632843_at:34:139; Interrogation_Position=766; Antisense; ACGATATCAGTAAGCGCACCTTCAA
>probe:Drosophila_2:1632843_at:92:253; Interrogation_Position=788; Antisense; CAAGCGCCTGCTGGACTTGGAGGAA
>probe:Drosophila_2:1632843_at:225:589; Interrogation_Position=805; Antisense; TGGAGGAAGGCCTGCCACTGCGTTT
>probe:Drosophila_2:1632843_at:576:143; Interrogation_Position=821; Antisense; ACTGCGTTTCGTGTCTTCCATGTGC
>probe:Drosophila_2:1632843_at:521:557; Interrogation_Position=849; Antisense; GGACTAACGGCATCCGTGCTCAGCA
>probe:Drosophila_2:1632843_at:99:653; Interrogation_Position=889; Antisense; TCAAGTCGCGGATGATGAACCAGCC
>probe:Drosophila_2:1632843_at:348:39; Interrogation_Position=934; Antisense; ATCTGTACTACAAGAACTCCCTCGA
>probe:Drosophila_2:1632843_at:613:383; Interrogation_Position=947; Antisense; GAACTCCCTCGACTGCGTTAGGAAG
>probe:Drosophila_2:1632843_at:338:549; Interrogation_Position=983; Antisense; GGAGGGTGTCCTCACGTTATATAAG

Paste this into a BLAST search page for me
TAAGGGCCTAATGCCCACTTGGTTTGGGACCGTTCTCAGTGCTCTTTTGGGGAGCAAACTATCAATCTTACTATCTGCAGGCCTTCGTGGACATCTACCGTGCATGCGTGCCTGCCTGATGACGAACGATATCAGTAAGCGCACCTTCAACAAGCGCCTGCTGGACTTGGAGGAATGGAGGAAGGCCTGCCACTGCGTTTACTGCGTTTCGTGTCTTCCATGTGCGGACTAACGGCATCCGTGCTCAGCATCAAGTCGCGGATGATGAACCAGCCATCTGTACTACAAGAACTCCCTCGAGAACTCCCTCGACTGCGTTAGGAAGGGAGGGTGTCCTCACGTTATATAAG

Full Affymetrix probeset data:

Annotations for 1632843_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720