FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632846_at:

>probe:Drosophila_2:1632846_at:426:31; Interrogation_Position=1147; Antisense; ATAAGCACTCGAGCAAGCTGCCTAT
>probe:Drosophila_2:1632846_at:256:39; Interrogation_Position=1181; Antisense; ATCTAAGAACGCCTACGCCTTGTAT
>probe:Drosophila_2:1632846_at:165:485; Interrogation_Position=1202; Antisense; GTATGCCGAACAAAATTGCCCGAGA
>probe:Drosophila_2:1632846_at:551:721; Interrogation_Position=1217; Antisense; TTGCCCGAGATCGTACAAGGCTGCT
>probe:Drosophila_2:1632846_at:13:227; Interrogation_Position=1233; Antisense; AAGGCTGCTGGCGAATACTTCTAGT
>probe:Drosophila_2:1632846_at:728:679; Interrogation_Position=1291; Antisense; TATGAATGTTTACCGCTGCAAGCCA
>probe:Drosophila_2:1632846_at:44:205; Interrogation_Position=1310; Antisense; AAGCCAAAGTCGTCGCCCTGCAAAG
>probe:Drosophila_2:1632846_at:8:61; Interrogation_Position=1348; Antisense; ATGTATCCCTACCTATTTGCTGTCA
>probe:Drosophila_2:1632846_at:32:693; Interrogation_Position=1363; Antisense; TTTGCTGTCATCCTGTTGGCATTAA
>probe:Drosophila_2:1632846_at:447:479; Interrogation_Position=1388; Antisense; GTTTCATTGTCATTCCAAGCGATGT
>probe:Drosophila_2:1632846_at:28:295; Interrogation_Position=1407; Antisense; CGATGTCAGCTTACTCAAACGCACA
>probe:Drosophila_2:1632846_at:594:151; Interrogation_Position=1429; Antisense; ACATCCGCAGCACAGTTCAAGTCAA
>probe:Drosophila_2:1632846_at:464:15; Interrogation_Position=1469; Antisense; ATTTTGCGATAAGCTTTACCTCTCC
>probe:Drosophila_2:1632846_at:5:699; Interrogation_Position=1483; Antisense; TTTACCTCTCCGATTGCACATTATA

Paste this into a BLAST search page for me
ATAAGCACTCGAGCAAGCTGCCTATATCTAAGAACGCCTACGCCTTGTATGTATGCCGAACAAAATTGCCCGAGATTGCCCGAGATCGTACAAGGCTGCTAAGGCTGCTGGCGAATACTTCTAGTTATGAATGTTTACCGCTGCAAGCCAAAGCCAAAGTCGTCGCCCTGCAAAGATGTATCCCTACCTATTTGCTGTCATTTGCTGTCATCCTGTTGGCATTAAGTTTCATTGTCATTCCAAGCGATGTCGATGTCAGCTTACTCAAACGCACAACATCCGCAGCACAGTTCAAGTCAAATTTTGCGATAAGCTTTACCTCTCCTTTACCTCTCCGATTGCACATTATA

Full Affymetrix probeset data:

Annotations for 1632846_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720