FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632847_at:

>probe:Drosophila_2:1632847_at:592:263; Interrogation_Position=103; Antisense; CAGCAATTCGGTGGCCAGCAGAAGC
>probe:Drosophila_2:1632847_at:441:55; Interrogation_Position=13; Antisense; ATGAGCACCCCTCGCAAGAACTATA
>probe:Drosophila_2:1632847_at:30:255; Interrogation_Position=137; Antisense; CAAACGTTGGCTTCTACGAGGACAA
>probe:Drosophila_2:1632847_at:479:267; Interrogation_Position=163; Antisense; CAGGGCCAGCAAAATGTTCCTCATT
>probe:Drosophila_2:1632847_at:199:695; Interrogation_Position=186; Antisense; TTTCTACCAGAACAAATCCCCACAG
>probe:Drosophila_2:1632847_at:524:41; Interrogation_Position=224; Antisense; ATCGGCCCTACGGTCAGGGCAGGAA
>probe:Drosophila_2:1632847_at:454:567; Interrogation_Position=262; Antisense; GGCAGCTTCAATCGCAGGAACCAAC
>probe:Drosophila_2:1632847_at:697:209; Interrogation_Position=28; Antisense; AAGAACTATAACAACCTGCCGCCCT
>probe:Drosophila_2:1632847_at:675:529; Interrogation_Position=293; Antisense; GGGATCATCCGAGGAGCCACCAGAA
>probe:Drosophila_2:1632847_at:319:281; Interrogation_Position=366; Antisense; CTCCATGCTGGAGGATCCTTGGCGG
>probe:Drosophila_2:1632847_at:445:655; Interrogation_Position=395; Antisense; TAATGGAACGGCACGAGGCCATCCA
>probe:Drosophila_2:1632847_at:437:265; Interrogation_Position=426; Antisense; CAGTACTAGCCGAACTTCACCGAAA
>probe:Drosophila_2:1632847_at:680:89; Interrogation_Position=71; Antisense; AGTACCCATCGCAGTCCGCGGATTA
>probe:Drosophila_2:1632847_at:361:303; Interrogation_Position=86; Antisense; CCGCGGATTACAGAGCGCAGCAATT

Paste this into a BLAST search page for me
CAGCAATTCGGTGGCCAGCAGAAGCATGAGCACCCCTCGCAAGAACTATACAAACGTTGGCTTCTACGAGGACAACAGGGCCAGCAAAATGTTCCTCATTTTTCTACCAGAACAAATCCCCACAGATCGGCCCTACGGTCAGGGCAGGAAGGCAGCTTCAATCGCAGGAACCAACAAGAACTATAACAACCTGCCGCCCTGGGATCATCCGAGGAGCCACCAGAACTCCATGCTGGAGGATCCTTGGCGGTAATGGAACGGCACGAGGCCATCCACAGTACTAGCCGAACTTCACCGAAAAGTACCCATCGCAGTCCGCGGATTACCGCGGATTACAGAGCGCAGCAATT

Full Affymetrix probeset data:

Annotations for 1632847_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720