FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632848_at:

>probe:Drosophila_2:1632848_at:29:393; Interrogation_Position=304; Antisense; GAAACCTGCATCCAGAAGTGGCGCA
>probe:Drosophila_2:1632848_at:146:221; Interrogation_Position=319; Antisense; AAGTGGCGCAGTCTTCTGGGTCCCA
>probe:Drosophila_2:1632848_at:550:251; Interrogation_Position=345; Antisense; CAAGGTGTTCCGTGCCGTGTACAGT
>probe:Drosophila_2:1632848_at:66:507; Interrogation_Position=356; Antisense; GTGCCGTGTACAGTGATCCCAACTG
>probe:Drosophila_2:1632848_at:546:605; Interrogation_Position=369; Antisense; TGATCCCAACTGCATCCGGGCATTG
>probe:Drosophila_2:1632848_at:359:669; Interrogation_Position=394; Antisense; TACGGAATATCCGACACTCGCAACG
>probe:Drosophila_2:1632848_at:484:65; Interrogation_Position=425; Antisense; ATGGATCCGACAGCGAGGCATCCGC
>probe:Drosophila_2:1632848_at:563:427; Interrogation_Position=457; Antisense; GAGATCAGCATCCTGTTCCCGGAGT
>probe:Drosophila_2:1632848_at:188:471; Interrogation_Position=471; Antisense; GTTCCCGGAGTTTGACGCGGCTGTT
>probe:Drosophila_2:1632848_at:423:485; Interrogation_Position=525; Antisense; GTAGTCGAGGAGTTCTTGATCCTTA
>probe:Drosophila_2:1632848_at:344:443; Interrogation_Position=560; Antisense; GATGTCTACTACCAAAGCAGTTCAT
>probe:Drosophila_2:1632848_at:338:479; Interrogation_Position=636; Antisense; GTTTCTTATTTTTAATGCCTGGCAT
>probe:Drosophila_2:1632848_at:643:233; Interrogation_Position=649; Antisense; AATGCCTGGCATTTTTAGATTAGTA
>probe:Drosophila_2:1632848_at:224:563; Interrogation_Position=839; Antisense; GGAATTTGGCAATGTTCTTTCGAAA

Paste this into a BLAST search page for me
GAAACCTGCATCCAGAAGTGGCGCAAAGTGGCGCAGTCTTCTGGGTCCCACAAGGTGTTCCGTGCCGTGTACAGTGTGCCGTGTACAGTGATCCCAACTGTGATCCCAACTGCATCCGGGCATTGTACGGAATATCCGACACTCGCAACGATGGATCCGACAGCGAGGCATCCGCGAGATCAGCATCCTGTTCCCGGAGTGTTCCCGGAGTTTGACGCGGCTGTTGTAGTCGAGGAGTTCTTGATCCTTAGATGTCTACTACCAAAGCAGTTCATGTTTCTTATTTTTAATGCCTGGCATAATGCCTGGCATTTTTAGATTAGTAGGAATTTGGCAATGTTCTTTCGAAA

Full Affymetrix probeset data:

Annotations for 1632848_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720