FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632849_at:

>probe:Drosophila_2:1632849_at:465:581; Interrogation_Position=292; Antisense; TGGCTCCCACCTCCAAGAAAGGAAG
>probe:Drosophila_2:1632849_at:177:375; Interrogation_Position=326; Antisense; GAAGACCGTTGTCCACCACAAAAGT
>probe:Drosophila_2:1632849_at:140:219; Interrogation_Position=347; Antisense; AAGTAAGGTCCACAAGCCGGGCAGA
>probe:Drosophila_2:1632849_at:130:567; Interrogation_Position=399; Antisense; GGCAAGCGCAGCGACCGCAAGAAGA
>probe:Drosophila_2:1632849_at:382:359; Interrogation_Position=415; Antisense; GCAAGAAGAGATCCCGACGAAACTA
>probe:Drosophila_2:1632849_at:483:89; Interrogation_Position=441; Antisense; AGTAGAGACCCCATTGCGAATACCC
>probe:Drosophila_2:1632849_at:487:323; Interrogation_Position=456; Antisense; GCGAATACCCCAGGCATAACAGATT
>probe:Drosophila_2:1632849_at:670:151; Interrogation_Position=474; Antisense; ACAGATTTGGCCAGACATGTCTTGG
>probe:Drosophila_2:1632849_at:268:153; Interrogation_Position=488; Antisense; ACATGTCTTGGCTTTTGTTCCCAAA
>probe:Drosophila_2:1632849_at:354:601; Interrogation_Position=503; Antisense; TGTTCCCAAACTTTTCATTTTCTAT
>probe:Drosophila_2:1632849_at:380:277; Interrogation_Position=532; Antisense; CTTATTCCTGTATTACCCTCAAGAT
>probe:Drosophila_2:1632849_at:208:33; Interrogation_Position=60; Antisense; ATAATTATTCTCTTCGCCATCGTGG
>probe:Drosophila_2:1632849_at:414:313; Interrogation_Position=75; Antisense; GCCATCGTGGCCTTTGTTTCGTCTG
>probe:Drosophila_2:1632849_at:425:695; Interrogation_Position=91; Antisense; TTTCGTCTGCCTGGGCAGTGACTGA

Paste this into a BLAST search page for me
TGGCTCCCACCTCCAAGAAAGGAAGGAAGACCGTTGTCCACCACAAAAGTAAGTAAGGTCCACAAGCCGGGCAGAGGCAAGCGCAGCGACCGCAAGAAGAGCAAGAAGAGATCCCGACGAAACTAAGTAGAGACCCCATTGCGAATACCCGCGAATACCCCAGGCATAACAGATTACAGATTTGGCCAGACATGTCTTGGACATGTCTTGGCTTTTGTTCCCAAATGTTCCCAAACTTTTCATTTTCTATCTTATTCCTGTATTACCCTCAAGATATAATTATTCTCTTCGCCATCGTGGGCCATCGTGGCCTTTGTTTCGTCTGTTTCGTCTGCCTGGGCAGTGACTGA

Full Affymetrix probeset data:

Annotations for 1632849_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720