Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632850_at:

>probe:Drosophila_2:1632850_at:113:637; Interrogation_Position=2205; Antisense; TCGTATTGTTCTCAAGCGCGTTGTT
>probe:Drosophila_2:1632850_at:606:205; Interrogation_Position=2218; Antisense; AAGCGCGTTGTTCTCAGCGGTCATC
>probe:Drosophila_2:1632850_at:699:121; Interrogation_Position=2233; Antisense; AGCGGTCATCCCATGCGTATCAATC
>probe:Drosophila_2:1632850_at:479:483; Interrogation_Position=2249; Antisense; GTATCAATCGCAAGTCGGCTTCTAT
>probe:Drosophila_2:1632850_at:696:275; Interrogation_Position=2267; Antisense; CTTCTATTCGCTACATGTTCTTCTA
>probe:Drosophila_2:1632850_at:55:443; Interrogation_Position=2299; Antisense; GATGTGGAGTACTTCAAGCCTGTGA
>probe:Drosophila_2:1632850_at:487:79; Interrogation_Position=2336; Antisense; AGTGCGGACGGCTGGGACACATTAA
>probe:Drosophila_2:1632850_at:250:657; Interrogation_Position=2358; Antisense; TAAGGAGTCACTGGGCACGCACGGC
>probe:Drosophila_2:1632850_at:590:141; Interrogation_Position=2378; Antisense; ACGGCCACATGAAGTGCTACTTTGA
>probe:Drosophila_2:1632850_at:345:693; Interrogation_Position=2398; Antisense; TTTGATGGGCAGTTGCGATCCTACG
>probe:Drosophila_2:1632850_at:443:399; Interrogation_Position=2422; Antisense; GACACTGCTTTCATGTACCTGTACA
>probe:Drosophila_2:1632850_at:603:425; Interrogation_Position=2448; Antisense; GAGAGTCTTCCCCAAATGGACCTAC
>probe:Drosophila_2:1632850_at:375:197; Interrogation_Position=2490; Antisense; AACGGCGGAGCACGAGCGACAACAT
>probe:Drosophila_2:1632850_at:227:419; Interrogation_Position=2532; Antisense; GAGCTCGCAGCAAGTGGCCATGGAA

Paste this into a BLAST search page for me
TCGTATTGTTCTCAAGCGCGTTGTTAAGCGCGTTGTTCTCAGCGGTCATCAGCGGTCATCCCATGCGTATCAATCGTATCAATCGCAAGTCGGCTTCTATCTTCTATTCGCTACATGTTCTTCTAGATGTGGAGTACTTCAAGCCTGTGAAGTGCGGACGGCTGGGACACATTAATAAGGAGTCACTGGGCACGCACGGCACGGCCACATGAAGTGCTACTTTGATTTGATGGGCAGTTGCGATCCTACGGACACTGCTTTCATGTACCTGTACAGAGAGTCTTCCCCAAATGGACCTACAACGGCGGAGCACGAGCGACAACATGAGCTCGCAGCAAGTGGCCATGGAA

Full Affymetrix probeset data:

Annotations for 1632850_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime