FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632855_at:

>probe:Drosophila_2:1632855_at:523:439; Interrogation_Position=1087; Antisense; GAGGCGCCGGATACAATCAACCAGA
>probe:Drosophila_2:1632855_at:207:445; Interrogation_Position=1129; Antisense; GATGAATATCGCAGACGCCGGGCCC
>probe:Drosophila_2:1632855_at:461:415; Interrogation_Position=1157; Antisense; GAGCCTCCTTGCTTGCTATGATTGA
>probe:Drosophila_2:1632855_at:574:153; Interrogation_Position=1278; Antisense; ACAGGAGCGTTTGGCCATGTTGAGC
>probe:Drosophila_2:1632855_at:607:279; Interrogation_Position=1314; Antisense; CTCCGTGCTTCGATATCTACCAAAG
>probe:Drosophila_2:1632855_at:259:209; Interrogation_Position=1336; Antisense; AAGCATGTCCTTAAGTCTACGGATA
>probe:Drosophila_2:1632855_at:58:643; Interrogation_Position=1351; Antisense; TCTACGGATAGGGAGCATTTCTGCC
>probe:Drosophila_2:1632855_at:540:345; Interrogation_Position=1365; Antisense; GCATTTCTGCCTAATTGACGCTCAG
>probe:Drosophila_2:1632855_at:502:521; Interrogation_Position=1400; Antisense; GTGGCGATTCCTAGTCAGTGGCATA
>probe:Drosophila_2:1632855_at:679:139; Interrogation_Position=928; Antisense; ACGGCCAAGAGTGACGAGCGCTATC
>probe:Drosophila_2:1632855_at:495:611; Interrogation_Position=939; Antisense; TGACGAGCGCTATCGCCAACAGATG
>probe:Drosophila_2:1632855_at:454:115; Interrogation_Position=965; Antisense; AGCAGGAGCAGATGTCTCGCCAGCG
>probe:Drosophila_2:1632855_at:720:631; Interrogation_Position=981; Antisense; TCGCCAGCGCACCAGACAGGAGTTG
>probe:Drosophila_2:1632855_at:450:399; Interrogation_Position=995; Antisense; GACAGGAGTTGGATCGCTATCGACA

Paste this into a BLAST search page for me
GAGGCGCCGGATACAATCAACCAGAGATGAATATCGCAGACGCCGGGCCCGAGCCTCCTTGCTTGCTATGATTGAACAGGAGCGTTTGGCCATGTTGAGCCTCCGTGCTTCGATATCTACCAAAGAAGCATGTCCTTAAGTCTACGGATATCTACGGATAGGGAGCATTTCTGCCGCATTTCTGCCTAATTGACGCTCAGGTGGCGATTCCTAGTCAGTGGCATAACGGCCAAGAGTGACGAGCGCTATCTGACGAGCGCTATCGCCAACAGATGAGCAGGAGCAGATGTCTCGCCAGCGTCGCCAGCGCACCAGACAGGAGTTGGACAGGAGTTGGATCGCTATCGACA

Full Affymetrix probeset data:

Annotations for 1632855_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720