FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632857_at:

>probe:Drosophila_2:1632857_at:520:209; Interrogation_Position=347; Antisense; AAGAATTTGACATCGTTTTGGCCAC
>probe:Drosophila_2:1632857_at:363:701; Interrogation_Position=362; Antisense; TTTTGGCCACGAAGTACAAGCGCTT
>probe:Drosophila_2:1632857_at:517:635; Interrogation_Position=390; Antisense; TCGCTTCCTGGCCAATGATATTGCT
>probe:Drosophila_2:1632857_at:434:605; Interrogation_Position=405; Antisense; TGATATTGCTCTGCTCAAGCTCAGC
>probe:Drosophila_2:1632857_at:598:665; Interrogation_Position=455; Antisense; TACAACCGATTTGCCTGATTCTCAA
>probe:Drosophila_2:1632857_at:643:309; Interrogation_Position=494; Antisense; CCAATGTGCACGAATTCCAGGCTTT
>probe:Drosophila_2:1632857_at:500:391; Interrogation_Position=535; Antisense; GAAACCAATCATTCCGCCAATGTGT
>probe:Drosophila_2:1632857_at:566:229; Interrogation_Position=553; Antisense; AATGTGTTGCAGACGACGGTTCTCA
>probe:Drosophila_2:1632857_at:277:535; Interrogation_Position=606; Antisense; GGTGCTGTCCATGCCAATCACAATT
>probe:Drosophila_2:1632857_at:282:35; Interrogation_Position=632; Antisense; ATCAGCTTTGCGTCGGATTTCAGGG
>probe:Drosophila_2:1632857_at:142:521; Interrogation_Position=683; Antisense; GTGGACCTCTGGTCACCAAGGTGAA
>probe:Drosophila_2:1632857_at:458:145; Interrogation_Position=707; Antisense; ACTACGACGGAGTTTGGCGCTACTT
>probe:Drosophila_2:1632857_at:533:397; Interrogation_Position=760; Antisense; GACAAGTGCCAAAGTCCCGGAGTGT
>probe:Drosophila_2:1632857_at:219:441; Interrogation_Position=809; Antisense; GATGGATCCGATACGTTATGCAGTC

Paste this into a BLAST search page for me
AAGAATTTGACATCGTTTTGGCCACTTTTGGCCACGAAGTACAAGCGCTTTCGCTTCCTGGCCAATGATATTGCTTGATATTGCTCTGCTCAAGCTCAGCTACAACCGATTTGCCTGATTCTCAACCAATGTGCACGAATTCCAGGCTTTGAAACCAATCATTCCGCCAATGTGTAATGTGTTGCAGACGACGGTTCTCAGGTGCTGTCCATGCCAATCACAATTATCAGCTTTGCGTCGGATTTCAGGGGTGGACCTCTGGTCACCAAGGTGAAACTACGACGGAGTTTGGCGCTACTTGACAAGTGCCAAAGTCCCGGAGTGTGATGGATCCGATACGTTATGCAGTC

Full Affymetrix probeset data:

Annotations for 1632857_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720