FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632860_at:

>probe:Drosophila_2:1632860_at:700:163; Interrogation_Position=1010; Antisense; AAATACTCTATAATCCCCAACTCAC
>probe:Drosophila_2:1632860_at:26:49; Interrogation_Position=525; Antisense; ATGCCTCTCCTCTGGTGGCCAAGGT
>probe:Drosophila_2:1632860_at:349:43; Interrogation_Position=669; Antisense; CCCTGGGCTACCACTAAGTCAGATG
>probe:Drosophila_2:1632860_at:541:665; Interrogation_Position=702; Antisense; TACACCACTCGAATAATGCCGACCT
>probe:Drosophila_2:1632860_at:686:305; Interrogation_Position=724; Antisense; CCTCTTGCCGCAACCGAATAATGGA
>probe:Drosophila_2:1632860_at:194:657; Interrogation_Position=742; Antisense; TAATGGACACATCGCGACCAACTTC
>probe:Drosophila_2:1632860_at:479:337; Interrogation_Position=796; Antisense; GCTCATGGGCCGATCATAGTCGATA
>probe:Drosophila_2:1632860_at:251:269; Interrogation_Position=868; Antisense; CATACGAATTCACGGACAGCGGATT
>probe:Drosophila_2:1632860_at:711:557; Interrogation_Position=881; Antisense; GGACAGCGGATTCCGATTGCCCAGT
>probe:Drosophila_2:1632860_at:418:463; Interrogation_Position=895; Antisense; GATTGCCCAGTCCTTGAGTTACGGA
>probe:Drosophila_2:1632860_at:507:429; Interrogation_Position=910; Antisense; GAGTTACGGATCCAATGTTCCCTCA
>probe:Drosophila_2:1632860_at:188:651; Interrogation_Position=942; Antisense; TCACACATTCTCGAGACCTTTCATT
>probe:Drosophila_2:1632860_at:81:61; Interrogation_Position=968; Antisense; ATGTTTCTTGTCTTCTTAATCTTAA
>probe:Drosophila_2:1632860_at:43:645; Interrogation_Position=987; Antisense; TCTTAAGGCTGTTTGACCGCGATAA

Paste this into a BLAST search page for me
AAATACTCTATAATCCCCAACTCACATGCCTCTCCTCTGGTGGCCAAGGTCCCTGGGCTACCACTAAGTCAGATGTACACCACTCGAATAATGCCGACCTCCTCTTGCCGCAACCGAATAATGGATAATGGACACATCGCGACCAACTTCGCTCATGGGCCGATCATAGTCGATACATACGAATTCACGGACAGCGGATTGGACAGCGGATTCCGATTGCCCAGTGATTGCCCAGTCCTTGAGTTACGGAGAGTTACGGATCCAATGTTCCCTCATCACACATTCTCGAGACCTTTCATTATGTTTCTTGTCTTCTTAATCTTAATCTTAAGGCTGTTTGACCGCGATAA

Full Affymetrix probeset data:

Annotations for 1632860_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720