FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632861_at:

>probe:Drosophila_2:1632861_at:501:459; Interrogation_Position=344; Antisense; GATTACCAGTTTGCTCGGAGTGCCG
>probe:Drosophila_2:1632861_at:10:119; Interrogation_Position=398; Antisense; AGCTCTTTCGCAAGTGGAAGCCTCT
>probe:Drosophila_2:1632861_at:389:321; Interrogation_Position=446; Antisense; GCGCCCTTAGGATTCTTAGTGTTGT
>probe:Drosophila_2:1632861_at:390:597; Interrogation_Position=468; Antisense; TGTGCGATGCTTCTTTCTGGACGAA
>probe:Drosophila_2:1632861_at:266:469; Interrogation_Position=504; Antisense; GTTGCTGTATGCCATGCAGGCCAAT
>probe:Drosophila_2:1632861_at:434:197; Interrogation_Position=557; Antisense; AACGGGCTGCCGATTGCTTTGAGCA
>probe:Drosophila_2:1632861_at:392:401; Interrogation_Position=598; Antisense; GACATGTTGGACTACTTCTATCGCA
>probe:Drosophila_2:1632861_at:590:353; Interrogation_Position=742; Antisense; GCAGCGCACCACTTCGAAAACGGAG
>probe:Drosophila_2:1632861_at:274:203; Interrogation_Position=768; Antisense; AACCATTGTGGTGTGCGCTACTGAA
>probe:Drosophila_2:1632861_at:662:381; Interrogation_Position=790; Antisense; GAACGGATTCCAGCTGGAGCCGAAA
>probe:Drosophila_2:1632861_at:636:395; Interrogation_Position=811; Antisense; GAAATCACCATGTCGTACGCCAAGT
>probe:Drosophila_2:1632861_at:420:311; Interrogation_Position=829; Antisense; GCCAAGTTACTATGGTCCACGCTGG
>probe:Drosophila_2:1632861_at:83:221; Interrogation_Position=895; Antisense; AAGTGCGTTCGATGCCAAGATCCCA
>probe:Drosophila_2:1632861_at:307:95; Interrogation_Position=912; Antisense; AGATCCCACGGTGAGTTCACTTGTA

Paste this into a BLAST search page for me
GATTACCAGTTTGCTCGGAGTGCCGAGCTCTTTCGCAAGTGGAAGCCTCTGCGCCCTTAGGATTCTTAGTGTTGTTGTGCGATGCTTCTTTCTGGACGAAGTTGCTGTATGCCATGCAGGCCAATAACGGGCTGCCGATTGCTTTGAGCAGACATGTTGGACTACTTCTATCGCAGCAGCGCACCACTTCGAAAACGGAGAACCATTGTGGTGTGCGCTACTGAAGAACGGATTCCAGCTGGAGCCGAAAGAAATCACCATGTCGTACGCCAAGTGCCAAGTTACTATGGTCCACGCTGGAAGTGCGTTCGATGCCAAGATCCCAAGATCCCACGGTGAGTTCACTTGTA

Full Affymetrix probeset data:

Annotations for 1632861_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720