FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632864_at:

>probe:Drosophila_2:1632864_at:574:337; Interrogation_Position=139; Antisense; GCTCAGCCGATCCAACAGGTTATTG
>probe:Drosophila_2:1632864_at:21:269; Interrogation_Position=154; Antisense; CAGGTTATTGCACCCATTCAACAGG
>probe:Drosophila_2:1632864_at:238:423; Interrogation_Position=212; Antisense; GAGAGGCCAGCCTGAATCACGAACT
>probe:Drosophila_2:1632864_at:727:127; Interrogation_Position=309; Antisense; ACCACCTGCCGTCGATTGGAAGAGG
>probe:Drosophila_2:1632864_at:445:425; Interrogation_Position=342; Antisense; GAGAGATCCCTTCGAGTGCCTGCAA
>probe:Drosophila_2:1632864_at:17:507; Interrogation_Position=357; Antisense; GTGCCTGCAATCGTTGATATGCCAA
>probe:Drosophila_2:1632864_at:102:25; Interrogation_Position=373; Antisense; ATATGCCAACTGATGTCCGGAGCGG
>probe:Drosophila_2:1632864_at:556:215; Interrogation_Position=404; Antisense; AAGTTCCAGAGGCTGAGTTGCTCAT
>probe:Drosophila_2:1632864_at:287:579; Interrogation_Position=462; Antisense; GGCCAAAATTGGTCGCGCCTTCAGT
>probe:Drosophila_2:1632864_at:336:315; Interrogation_Position=478; Antisense; GCCTTCAGTCGAGGATTGGCCTTGA
>probe:Drosophila_2:1632864_at:639:199; Interrogation_Position=526; Antisense; AACGAATATCCATTTTGCCTCTACT
>probe:Drosophila_2:1632864_at:454:313; Interrogation_Position=55; Antisense; GCCATGTACATGATGCATCTGCTCG
>probe:Drosophila_2:1632864_at:526:323; Interrogation_Position=567; Antisense; GCGCATCCTGCGTTGGTTCAGTGAA
>probe:Drosophila_2:1632864_at:301:213; Interrogation_Position=94; Antisense; AAGATCCGACCCATTCGCGGAATAA

Paste this into a BLAST search page for me
GCTCAGCCGATCCAACAGGTTATTGCAGGTTATTGCACCCATTCAACAGGGAGAGGCCAGCCTGAATCACGAACTACCACCTGCCGTCGATTGGAAGAGGGAGAGATCCCTTCGAGTGCCTGCAAGTGCCTGCAATCGTTGATATGCCAAATATGCCAACTGATGTCCGGAGCGGAAGTTCCAGAGGCTGAGTTGCTCATGGCCAAAATTGGTCGCGCCTTCAGTGCCTTCAGTCGAGGATTGGCCTTGAAACGAATATCCATTTTGCCTCTACTGCCATGTACATGATGCATCTGCTCGGCGCATCCTGCGTTGGTTCAGTGAAAAGATCCGACCCATTCGCGGAATAA

Full Affymetrix probeset data:

Annotations for 1632864_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720