FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632869_at:

>probe:Drosophila_2:1632869_at:589:491; Interrogation_Position=3856; Antisense; GTAAACGCGCGCATCAGGCGCATAT
>probe:Drosophila_2:1632869_at:703:29; Interrogation_Position=3923; Antisense; ATAAGTCAGGTTGCTTGGCCCCTTC
>probe:Drosophila_2:1632869_at:148:319; Interrogation_Position=3940; Antisense; GCCCCTTCCCAATGGCAGACGTGGA
>probe:Drosophila_2:1632869_at:526:221; Interrogation_Position=3992; Antisense; AAGTGGAGCCCAGTCTGATCTGATC
>probe:Drosophila_2:1632869_at:640:43; Interrogation_Position=4019; Antisense; ATCCGATCCGGTCTGGTTGGATCTA
>probe:Drosophila_2:1632869_at:38:729; Interrogation_Position=4035; Antisense; TTGGATCTACTCCTAGCTTCTAGCT
>probe:Drosophila_2:1632869_at:679:571; Interrogation_Position=4070; Antisense; GGCTCCATGCGGCAACTCTTTGGTT
>probe:Drosophila_2:1632869_at:68:193; Interrogation_Position=4083; Antisense; AACTCTTTGGTTGCTTCTACCGACT
>probe:Drosophila_2:1632869_at:400:713; Interrogation_Position=4097; Antisense; TTCTACCGACTTTTCATTGCCTGCT
>probe:Drosophila_2:1632869_at:380:317; Interrogation_Position=4115; Antisense; GCCTGCTCACTACTCACTAATATAG
>probe:Drosophila_2:1632869_at:265:19; Interrogation_Position=4134; Antisense; ATATAGCTTACTCAACATACGACGT
>probe:Drosophila_2:1632869_at:35:127; Interrogation_Position=4152; Antisense; ACGACGTACATATAGCAACTCCTGC
>probe:Drosophila_2:1632869_at:232:415; Interrogation_Position=4246; Antisense; GACCACCATAGACCCGAAATGCACA
>probe:Drosophila_2:1632869_at:11:173; Interrogation_Position=4278; Antisense; AAAGCAGGCAAATCCGCAAGCCGAA

Paste this into a BLAST search page for me
GTAAACGCGCGCATCAGGCGCATATATAAGTCAGGTTGCTTGGCCCCTTCGCCCCTTCCCAATGGCAGACGTGGAAAGTGGAGCCCAGTCTGATCTGATCATCCGATCCGGTCTGGTTGGATCTATTGGATCTACTCCTAGCTTCTAGCTGGCTCCATGCGGCAACTCTTTGGTTAACTCTTTGGTTGCTTCTACCGACTTTCTACCGACTTTTCATTGCCTGCTGCCTGCTCACTACTCACTAATATAGATATAGCTTACTCAACATACGACGTACGACGTACATATAGCAACTCCTGCGACCACCATAGACCCGAAATGCACAAAAGCAGGCAAATCCGCAAGCCGAA

Full Affymetrix probeset data:

Annotations for 1632869_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720