FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632870_at:

>probe:Drosophila_2:1632870_at:689:417; Interrogation_Position=124; Antisense; GAGCTGTTTCTCTCGTGTATACCGA
>probe:Drosophila_2:1632870_at:140:439; Interrogation_Position=147; Antisense; GAGGAATCACAGTTGTTCTCCGCGG
>probe:Drosophila_2:1632870_at:552:701; Interrogation_Position=232; Antisense; TTTTCGGGAAATTCTCGCGGCTACG
>probe:Drosophila_2:1632870_at:535:331; Interrogation_Position=248; Antisense; GCGGCTACGCCTACTTGCAATATAT
>probe:Drosophila_2:1632870_at:475:555; Interrogation_Position=279; Antisense; GGACCTCAAGGAATCGGCAATGCAA
>probe:Drosophila_2:1632870_at:583:241; Interrogation_Position=302; Antisense; AATATCTGCCAATGCGATTCCGACA
>probe:Drosophila_2:1632870_at:623:9; Interrogation_Position=318; Antisense; ATTCCGACAGCTTTGCATGTGCTTA
>probe:Drosophila_2:1632870_at:564:367; Interrogation_Position=391; Antisense; GAATCGTCGCTTAGACCATGGCAAG
>probe:Drosophila_2:1632870_at:647:215; Interrogation_Position=433; Antisense; AAGATACATCCCTTTACCATCGTTC
>probe:Drosophila_2:1632870_at:397:319; Interrogation_Position=520; Antisense; GCCGCAAGTGCCCATCAGAGAGTAA
>probe:Drosophila_2:1632870_at:632:245; Interrogation_Position=560; Antisense; AATTCGGTGAGCATGCGCACATCTC
>probe:Drosophila_2:1632870_at:299:385; Interrogation_Position=600; Antisense; GAACATCTTGAGCAGAGCCAGCGGT
>probe:Drosophila_2:1632870_at:690:121; Interrogation_Position=619; Antisense; AGCGGTAGCTTCTGTTTTCAACGGG
>probe:Drosophila_2:1632870_at:639:125; Interrogation_Position=649; Antisense; AGCCAAAATCGTACTCGACGCGTTC

Paste this into a BLAST search page for me
GAGCTGTTTCTCTCGTGTATACCGAGAGGAATCACAGTTGTTCTCCGCGGTTTTCGGGAAATTCTCGCGGCTACGGCGGCTACGCCTACTTGCAATATATGGACCTCAAGGAATCGGCAATGCAAAATATCTGCCAATGCGATTCCGACAATTCCGACAGCTTTGCATGTGCTTAGAATCGTCGCTTAGACCATGGCAAGAAGATACATCCCTTTACCATCGTTCGCCGCAAGTGCCCATCAGAGAGTAAAATTCGGTGAGCATGCGCACATCTCGAACATCTTGAGCAGAGCCAGCGGTAGCGGTAGCTTCTGTTTTCAACGGGAGCCAAAATCGTACTCGACGCGTTC

Full Affymetrix probeset data:

Annotations for 1632870_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720