FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632872_at:

>probe:Drosophila_2:1632872_at:649:275; Interrogation_Position=114; Antisense; CTTTATCTACGGAGGATGTCAAGGC
>probe:Drosophila_2:1632872_at:700:479; Interrogation_Position=15; Antisense; GTTTGCAGAAATTTGTGGATTACCA
>probe:Drosophila_2:1632872_at:550:213; Interrogation_Position=164; Antisense; AAGAGTTCTGTGGATTACCCGCTGC
>probe:Drosophila_2:1632872_at:352:303; Interrogation_Position=182; Antisense; CCGCTGCCGCTAATGGTAATTGCTT
>probe:Drosophila_2:1632872_at:722:247; Interrogation_Position=199; Antisense; AATTGCTTGGCATTGTTTTCTCGCT
>probe:Drosophila_2:1632872_at:463:715; Interrogation_Position=216; Antisense; TTCTCGCTGGTCTTATGATGCTCAA
>probe:Drosophila_2:1632872_at:611:445; Interrogation_Position=232; Antisense; GATGCTCAATATAACGTATGCTTTA
>probe:Drosophila_2:1632872_at:374:683; Interrogation_Position=248; Antisense; TATGCTTTAATTTTATCTACGGCGG
>probe:Drosophila_2:1632872_at:727:31; Interrogation_Position=262; Antisense; ATCTACGGCGGATGTCAGGGCAACG
>probe:Drosophila_2:1632872_at:232:387; Interrogation_Position=286; Antisense; GAAAATTCATTTGAATCCCAGGAAG
>probe:Drosophila_2:1632872_at:621:83; Interrogation_Position=49; Antisense; AGTGGCAAGTGCTTGGCATATTTCA
>probe:Drosophila_2:1632872_at:100:571; Interrogation_Position=63; Antisense; GGCATATTTCAAGCTCTGGACCTAT
>probe:Drosophila_2:1632872_at:254:207; Interrogation_Position=73; Antisense; AAGCTCTGGACCTATGATTCCAAAA
>probe:Drosophila_2:1632872_at:313:385; Interrogation_Position=99; Antisense; GAACAAATGCGTTATCTTTATCTAC

Paste this into a BLAST search page for me
CTTTATCTACGGAGGATGTCAAGGCGTTTGCAGAAATTTGTGGATTACCAAAGAGTTCTGTGGATTACCCGCTGCCCGCTGCCGCTAATGGTAATTGCTTAATTGCTTGGCATTGTTTTCTCGCTTTCTCGCTGGTCTTATGATGCTCAAGATGCTCAATATAACGTATGCTTTATATGCTTTAATTTTATCTACGGCGGATCTACGGCGGATGTCAGGGCAACGGAAAATTCATTTGAATCCCAGGAAGAGTGGCAAGTGCTTGGCATATTTCAGGCATATTTCAAGCTCTGGACCTATAAGCTCTGGACCTATGATTCCAAAAGAACAAATGCGTTATCTTTATCTAC

Full Affymetrix probeset data:

Annotations for 1632872_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720