Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632873_at:

>probe:Drosophila_2:1632873_at:41:31; Interrogation_Position=123; Antisense; ATACAACTCAATCAAGATGCCTTGC
>probe:Drosophila_2:1632873_at:630:509; Interrogation_Position=13; Antisense; GTGCATCAGTTGTGGTCAGCAGCAA
>probe:Drosophila_2:1632873_at:224:49; Interrogation_Position=139; Antisense; ATGCCTTGCCCATGCGGAAGCGGAT
>probe:Drosophila_2:1632873_at:102:207; Interrogation_Position=156; Antisense; AAGCGGATGCAAATGCGCCAGCCAG
>probe:Drosophila_2:1632873_at:661:69; Interrogation_Position=179; Antisense; AGGCCACCAAGGGATCCTGCAACTG
>probe:Drosophila_2:1632873_at:551:283; Interrogation_Position=195; Antisense; CTGCAACTGCGGATCTGACTGCAAG
>probe:Drosophila_2:1632873_at:384:285; Interrogation_Position=209; Antisense; CTGACTGCAAGTGCGGCGGCGACAA
>probe:Drosophila_2:1632873_at:185:323; Interrogation_Position=227; Antisense; GCGACAAGAAATCCGCCTGCGGCTG
>probe:Drosophila_2:1632873_at:305:623; Interrogation_Position=244; Antisense; TGCGGCTGCTCCGAGTGAGCTTTCC
>probe:Drosophila_2:1632873_at:652:451; Interrogation_Position=278; Antisense; GATCTGGAGTAGAGGCGCTGCATCT
>probe:Drosophila_2:1632873_at:714:99; Interrogation_Position=288; Antisense; AGAGGCGCTGCATCTTGTCTCTCTA
>probe:Drosophila_2:1632873_at:68:281; Interrogation_Position=308; Antisense; CTCTACACACCCTGCAATAAATGTC
>probe:Drosophila_2:1632873_at:31:221; Interrogation_Position=42; Antisense; AAGTGAATCATCTCAGTGCAACTAA
>probe:Drosophila_2:1632873_at:552:305; Interrogation_Position=69; Antisense; GCCTAAATAGCCCATACCTACCTTT

Paste this into a BLAST search page for me
ATACAACTCAATCAAGATGCCTTGCGTGCATCAGTTGTGGTCAGCAGCAAATGCCTTGCCCATGCGGAAGCGGATAAGCGGATGCAAATGCGCCAGCCAGAGGCCACCAAGGGATCCTGCAACTGCTGCAACTGCGGATCTGACTGCAAGCTGACTGCAAGTGCGGCGGCGACAAGCGACAAGAAATCCGCCTGCGGCTGTGCGGCTGCTCCGAGTGAGCTTTCCGATCTGGAGTAGAGGCGCTGCATCTAGAGGCGCTGCATCTTGTCTCTCTACTCTACACACCCTGCAATAAATGTCAAGTGAATCATCTCAGTGCAACTAAGCCTAAATAGCCCATACCTACCTTT

Full Affymetrix probeset data:

Annotations for 1632873_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime