FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632874_at:

>probe:Drosophila_2:1632874_at:71:619; Interrogation_Position=1011; Antisense; TGCTTTTTATAGTGCCTTCTGGCGT
>probe:Drosophila_2:1632874_at:253:329; Interrogation_Position=1032; Antisense; GCGTAGTCGCTACATCCTCATGGAA
>probe:Drosophila_2:1632874_at:510:65; Interrogation_Position=1051; Antisense; ATGGAACCAGCCACTGCAATTGCGA
>probe:Drosophila_2:1632874_at:596:81; Interrogation_Position=1155; Antisense; AGGGATTGCCTTTTACGATGCTGCC
>probe:Drosophila_2:1632874_at:717:181; Interrogation_Position=1184; Antisense; AAAACTCTGTTCTGTGCGGTGGCGA
>probe:Drosophila_2:1632874_at:92:327; Interrogation_Position=1226; Antisense; GCGAGGAGCATCACGTCTACACAAG
>probe:Drosophila_2:1632874_at:365:551; Interrogation_Position=1260; Antisense; GGAGTTCTCAGCTCATCAGGCAGAG
>probe:Drosophila_2:1632874_at:252:101; Interrogation_Position=1281; Antisense; AGAGTGCACCTGGAGCCTCGAAGAC
>probe:Drosophila_2:1632874_at:490:105; Interrogation_Position=757; Antisense; AGAAATTTGCTTTCGCAGCCTGGGT
>probe:Drosophila_2:1632874_at:310:393; Interrogation_Position=814; Antisense; GAAATCTATGCACACCTTCCGAAAG
>probe:Drosophila_2:1632874_at:387:193; Interrogation_Position=845; Antisense; AACTGCTGTACACCGCTCGAAAAGT
>probe:Drosophila_2:1632874_at:404:105; Interrogation_Position=920; Antisense; AGACGTACCTCATCTGCAGTAACGC
>probe:Drosophila_2:1632874_at:321:371; Interrogation_Position=957; Antisense; GAAGGCTGCGTATTTCATCCAACGT
>probe:Drosophila_2:1632874_at:348:125; Interrogation_Position=997; Antisense; AGCCGGCCGCAATTTGCTTTTTATA

Paste this into a BLAST search page for me
TGCTTTTTATAGTGCCTTCTGGCGTGCGTAGTCGCTACATCCTCATGGAAATGGAACCAGCCACTGCAATTGCGAAGGGATTGCCTTTTACGATGCTGCCAAAACTCTGTTCTGTGCGGTGGCGAGCGAGGAGCATCACGTCTACACAAGGGAGTTCTCAGCTCATCAGGCAGAGAGAGTGCACCTGGAGCCTCGAAGACAGAAATTTGCTTTCGCAGCCTGGGTGAAATCTATGCACACCTTCCGAAAGAACTGCTGTACACCGCTCGAAAAGTAGACGTACCTCATCTGCAGTAACGCGAAGGCTGCGTATTTCATCCAACGTAGCCGGCCGCAATTTGCTTTTTATA

Full Affymetrix probeset data:

Annotations for 1632874_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720