Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632875_at:

>probe:Drosophila_2:1632875_at:310:647; Interrogation_Position=1688; Antisense; TCAGCAGTTGCTGGCCAAATCGTCA
>probe:Drosophila_2:1632875_at:463:311; Interrogation_Position=1701; Antisense; GCCAAATCGTCAAGCGGACTTTCCG
>probe:Drosophila_2:1632875_at:416:557; Interrogation_Position=1716; Antisense; GGACTTTCCGCCCAAATGGATGCAG
>probe:Drosophila_2:1632875_at:359:729; Interrogation_Position=1742; Antisense; TTGGCGCAAGGAATTCAGCGAGCTA
>probe:Drosophila_2:1632875_at:264:427; Interrogation_Position=1768; Antisense; GAGATTTTGTAGACCAGCGCTGCGA
>probe:Drosophila_2:1632875_at:217:363; Interrogation_Position=1806; Antisense; GAATTGGAGTACGTTACCTTCTCTA
>probe:Drosophila_2:1632875_at:268:129; Interrogation_Position=1821; Antisense; ACCTTCTCTAATCAGCGGCTATTGG
>probe:Drosophila_2:1632875_at:247:445; Interrogation_Position=1853; Antisense; GATGACCAACTACATGGACCAGCAG
>probe:Drosophila_2:1632875_at:640:129; Interrogation_Position=1885; Antisense; ACACAAGGGAGATCCGGGACGCCCT
>probe:Drosophila_2:1632875_at:212:321; Interrogation_Position=1905; Antisense; GCCCTGGCTTTACTACTTCAAGGAG
>probe:Drosophila_2:1632875_at:24:97; Interrogation_Position=1928; Antisense; AGATAGCTTCATGCGCGAGTTCTCG
>probe:Drosophila_2:1632875_at:474:429; Interrogation_Position=1944; Antisense; GAGTTCTCGCGCCTACAAAATGAAA
>probe:Drosophila_2:1632875_at:341:679; Interrogation_Position=2131; Antisense; TAGGTTTTGGCGTCTCATGAGTTTT
>probe:Drosophila_2:1632875_at:683:507; Interrogation_Position=2258; Antisense; GTGCTGCCAAAAGTGTAATGCGATA

Paste this into a BLAST search page for me
TCAGCAGTTGCTGGCCAAATCGTCAGCCAAATCGTCAAGCGGACTTTCCGGGACTTTCCGCCCAAATGGATGCAGTTGGCGCAAGGAATTCAGCGAGCTAGAGATTTTGTAGACCAGCGCTGCGAGAATTGGAGTACGTTACCTTCTCTAACCTTCTCTAATCAGCGGCTATTGGGATGACCAACTACATGGACCAGCAGACACAAGGGAGATCCGGGACGCCCTGCCCTGGCTTTACTACTTCAAGGAGAGATAGCTTCATGCGCGAGTTCTCGGAGTTCTCGCGCCTACAAAATGAAATAGGTTTTGGCGTCTCATGAGTTTTGTGCTGCCAAAAGTGTAATGCGATA

Full Affymetrix probeset data:

Annotations for 1632875_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime