FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632878_at:

>probe:Drosophila_2:1632878_at:142:119; Interrogation_Position=1004; Antisense; AGCTCTCCCGCGTGCAGTGAAGACT
>probe:Drosophila_2:1632878_at:115:407; Interrogation_Position=1025; Antisense; GACTGTTTTTGGTCTGATACTGAAC
>probe:Drosophila_2:1632878_at:356:605; Interrogation_Position=1039; Antisense; TGATACTGAACCTAGCCACTGCAAG
>probe:Drosophila_2:1632878_at:16:471; Interrogation_Position=1105; Antisense; GTTCGAATCTCCCTCCATTGAAAAG
>probe:Drosophila_2:1632878_at:426:419; Interrogation_Position=1169; Antisense; GAGCTAGCCGTCTTGAATGATGATT
>probe:Drosophila_2:1632878_at:502:193; Interrogation_Position=690; Antisense; AACTGCAGCTGCGTGGTGTTGGCAT
>probe:Drosophila_2:1632878_at:367:513; Interrogation_Position=705; Antisense; GTGTTGGCATATTACCGGGCGATAT
>probe:Drosophila_2:1632878_at:335:725; Interrogation_Position=741; Antisense; TTGAATCACTTATGCGCACGTTTAG
>probe:Drosophila_2:1632878_at:507:355; Interrogation_Position=756; Antisense; GCACGTTTAGAGCACAGCGAGATTC
>probe:Drosophila_2:1632878_at:165:629; Interrogation_Position=828; Antisense; TCCAGACTCCTATTGATTTCACCAA
>probe:Drosophila_2:1632878_at:426:333; Interrogation_Position=853; Antisense; GCTGGATGTATTTTCCGAGCACAGT
>probe:Drosophila_2:1632878_at:665:407; Interrogation_Position=890; Antisense; GACGATGCGTCCTGGTTCAAAGAAT
>probe:Drosophila_2:1632878_at:170:363; Interrogation_Position=911; Antisense; GAATTGGAGCCGAAACCGGATCCCG
>probe:Drosophila_2:1632878_at:419:419; Interrogation_Position=955; Antisense; GAGCTCTAGCGATTCCGTTGTCAAT

Paste this into a BLAST search page for me
AGCTCTCCCGCGTGCAGTGAAGACTGACTGTTTTTGGTCTGATACTGAACTGATACTGAACCTAGCCACTGCAAGGTTCGAATCTCCCTCCATTGAAAAGGAGCTAGCCGTCTTGAATGATGATTAACTGCAGCTGCGTGGTGTTGGCATGTGTTGGCATATTACCGGGCGATATTTGAATCACTTATGCGCACGTTTAGGCACGTTTAGAGCACAGCGAGATTCTCCAGACTCCTATTGATTTCACCAAGCTGGATGTATTTTCCGAGCACAGTGACGATGCGTCCTGGTTCAAAGAATGAATTGGAGCCGAAACCGGATCCCGGAGCTCTAGCGATTCCGTTGTCAAT

Full Affymetrix probeset data:

Annotations for 1632878_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720