Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632879_at:

>probe:Drosophila_2:1632879_at:491:57; Interrogation_Position=13; Antisense; ATGAGTTTGCTAACAGCACAGCCAG
>probe:Drosophila_2:1632879_at:481:433; Interrogation_Position=142; Antisense; GAGTGTGATCCGAGACATTCCCATA
>probe:Drosophila_2:1632879_at:415:45; Interrogation_Position=149; Antisense; ATCCGAGACATTCCCATAAGCCAAA
>probe:Drosophila_2:1632879_at:341:443; Interrogation_Position=175; Antisense; GATGATTCCCATTTGAAGATGATCC
>probe:Drosophila_2:1632879_at:173:375; Interrogation_Position=189; Antisense; GAAGATGATCCTAGTCGTTGACATA
>probe:Drosophila_2:1632879_at:630:551; Interrogation_Position=225; Antisense; GGAGAGCTTTGTTTTTGGCTTCTTG
>probe:Drosophila_2:1632879_at:86:585; Interrogation_Position=240; Antisense; TGGCTTCTTGGGTCCTCAATGGGAA
>probe:Drosophila_2:1632879_at:469:155; Interrogation_Position=25; Antisense; ACAGCACAGCCAGACATCGTTTGTT
>probe:Drosophila_2:1632879_at:534:593; Interrogation_Position=259; Antisense; TGGGAAGGATATGCTGCCCGTGCAC
>probe:Drosophila_2:1632879_at:358:625; Interrogation_Position=273; Antisense; TGCCCGTGCACGTAATTCTTCATAT
>probe:Drosophila_2:1632879_at:649:137; Interrogation_Position=282; Antisense; ACGTAATTCTTCATATCGTCGTTTA
>probe:Drosophila_2:1632879_at:618:21; Interrogation_Position=294; Antisense; ATATCGTCGTTTAATCGCCTTCCTG
>probe:Drosophila_2:1632879_at:63:721; Interrogation_Position=313; Antisense; TTCCTGCCCTATGCACTATATATCA
>probe:Drosophila_2:1632879_at:661:39; Interrogation_Position=40; Antisense; ATCGTTTGTTGGATGACACTGGAAG

Paste this into a BLAST search page for me
ATGAGTTTGCTAACAGCACAGCCAGGAGTGTGATCCGAGACATTCCCATAATCCGAGACATTCCCATAAGCCAAAGATGATTCCCATTTGAAGATGATCCGAAGATGATCCTAGTCGTTGACATAGGAGAGCTTTGTTTTTGGCTTCTTGTGGCTTCTTGGGTCCTCAATGGGAAACAGCACAGCCAGACATCGTTTGTTTGGGAAGGATATGCTGCCCGTGCACTGCCCGTGCACGTAATTCTTCATATACGTAATTCTTCATATCGTCGTTTAATATCGTCGTTTAATCGCCTTCCTGTTCCTGCCCTATGCACTATATATCAATCGTTTGTTGGATGACACTGGAAG

Full Affymetrix probeset data:

Annotations for 1632879_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime