Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632880_a_at:

>probe:Drosophila_2:1632880_a_at:484:195; Interrogation_Position=114; Antisense; AACTGAGCGCACTGAACGGCCAAGT
>probe:Drosophila_2:1632880_a_at:390:263; Interrogation_Position=171; Antisense; CAGCGATTCGATCAGCAGTTCAATA
>probe:Drosophila_2:1632880_a_at:571:231; Interrogation_Position=199; Antisense; AATGCAACTGGAAGCGGCGGCGAAA
>probe:Drosophila_2:1632880_a_at:678:597; Interrogation_Position=249; Antisense; TGTCCGCCGTGTTCATATAGTCATC
>probe:Drosophila_2:1632880_a_at:176:23; Interrogation_Position=263; Antisense; ATATAGTCATCTCCATCATCGTCGT
>probe:Drosophila_2:1632880_a_at:568:643; Interrogation_Position=278; Antisense; TCATCGTCGTCACTGGCATCGGCAT
>probe:Drosophila_2:1632880_a_at:156:639; Interrogation_Position=320; Antisense; TCGTCATAGCCAGCATCATCAACGT
>probe:Drosophila_2:1632880_a_at:436:681; Interrogation_Position=348; Antisense; TATCGTCATCGTGGCAAGTGTTGTC
>probe:Drosophila_2:1632880_a_at:130:221; Interrogation_Position=363; Antisense; AAGTGTTGTCGTTGTCGCGACGCGT
>probe:Drosophila_2:1632880_a_at:679:191; Interrogation_Position=439; Antisense; AACTACATTGCCACATGTGCCCGGG
>probe:Drosophila_2:1632880_a_at:389:45; Interrogation_Position=582; Antisense; ATCGCGACTCGAATTCATACTGTAC
>probe:Drosophila_2:1632880_a_at:243:601; Interrogation_Position=602; Antisense; TGTACACGGAAGTCTACCAAGTCGA
>probe:Drosophila_2:1632880_a_at:176:543; Interrogation_Position=630; Antisense; GGATTCGGTTTCCTCCAGCGATTTC
>probe:Drosophila_2:1632880_a_at:658:325; Interrogation_Position=677; Antisense; GCGACGAGCCCTTCTGGCAGAATTA

Paste this into a BLAST search page for me
AACTGAGCGCACTGAACGGCCAAGTCAGCGATTCGATCAGCAGTTCAATAAATGCAACTGGAAGCGGCGGCGAAATGTCCGCCGTGTTCATATAGTCATCATATAGTCATCTCCATCATCGTCGTTCATCGTCGTCACTGGCATCGGCATTCGTCATAGCCAGCATCATCAACGTTATCGTCATCGTGGCAAGTGTTGTCAAGTGTTGTCGTTGTCGCGACGCGTAACTACATTGCCACATGTGCCCGGGATCGCGACTCGAATTCATACTGTACTGTACACGGAAGTCTACCAAGTCGAGGATTCGGTTTCCTCCAGCGATTTCGCGACGAGCCCTTCTGGCAGAATTA

Full Affymetrix probeset data:

Annotations for 1632880_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime