FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632882_at:

>probe:Drosophila_2:1632882_at:710:589; Interrogation_Position=114; Antisense; TGGATTCAGCCATCTCAGAGATAAT
>probe:Drosophila_2:1632882_at:461:99; Interrogation_Position=130; Antisense; AGAGATAATCAATGCCCTGGCTATA
>probe:Drosophila_2:1632882_at:562:305; Interrogation_Position=145; Antisense; CCTGGCTATACTGGCCGACGATAAA
>probe:Drosophila_2:1632882_at:208:469; Interrogation_Position=178; Antisense; GTTGACCATCAAGGAGGCCGGCAAG
>probe:Drosophila_2:1632882_at:341:417; Interrogation_Position=204; Antisense; GAGCTGCAATTTGTGCTGGCGCTGC
>probe:Drosophila_2:1632882_at:31:449; Interrogation_Position=232; Antisense; GATCGGAGGACTACTGCTGGGCCCC
>probe:Drosophila_2:1632882_at:163:649; Interrogation_Position=291; Antisense; TCACCGCCTACGGACTTACGGAGGG
>probe:Drosophila_2:1632882_at:655:495; Interrogation_Position=363; Antisense; GTCAGCGTCGAGAACTGGAGCAGCA
>probe:Drosophila_2:1632882_at:631:419; Interrogation_Position=380; Antisense; GAGCAGCACGTGATCAGGGCCATAT
>probe:Drosophila_2:1632882_at:354:229; Interrogation_Position=416; Antisense; AATGTACGCGTTCGAGATGTCGCAA
>probe:Drosophila_2:1632882_at:255:361; Interrogation_Position=45; Antisense; GTTGTTAGAAAGATCGTCACCGGGA
>probe:Drosophila_2:1632882_at:324:469; Interrogation_Position=473; Antisense; GTTGCACTCGAAGCAGTCAAGTCCT
>probe:Drosophila_2:1632882_at:197:495; Interrogation_Position=488; Antisense; GTCAAGTCCTATATCACTGATCGTA
>probe:Drosophila_2:1632882_at:14:565; Interrogation_Position=515; Antisense; GGAATGACCATCGTTGATTAGGCAT

Paste this into a BLAST search page for me
TGGATTCAGCCATCTCAGAGATAATAGAGATAATCAATGCCCTGGCTATACCTGGCTATACTGGCCGACGATAAAGTTGACCATCAAGGAGGCCGGCAAGGAGCTGCAATTTGTGCTGGCGCTGCGATCGGAGGACTACTGCTGGGCCCCTCACCGCCTACGGACTTACGGAGGGGTCAGCGTCGAGAACTGGAGCAGCAGAGCAGCACGTGATCAGGGCCATATAATGTACGCGTTCGAGATGTCGCAAGTTGTTAGAAAGATCGTCACCGGGAGTTGCACTCGAAGCAGTCAAGTCCTGTCAAGTCCTATATCACTGATCGTAGGAATGACCATCGTTGATTAGGCAT

Full Affymetrix probeset data:

Annotations for 1632882_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720