FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632883_at:

>probe:Drosophila_2:1632883_at:209:665; Interrogation_Position=1009; Antisense; TACAACACGCTTCTTAGTCTCGACT
>probe:Drosophila_2:1632883_at:433:301; Interrogation_Position=1044; Antisense; CCGCTTCTCAAACTTCTCGGAAAAG
>probe:Drosophila_2:1632883_at:322:471; Interrogation_Position=1068; Antisense; GTTCGATCCGTACCATATAATCAGG
>probe:Drosophila_2:1632883_at:13:81; Interrogation_Position=1119; Antisense; AGGTGAGCTTCAGATGCGTACAATG
>probe:Drosophila_2:1632883_at:522:651; Interrogation_Position=1176; Antisense; TAAGGTTCATGAGCGGGTCACACAC
>probe:Drosophila_2:1632883_at:620:537; Interrogation_Position=1191; Antisense; GGTCACACACCATCAGATCTGCAAG
>probe:Drosophila_2:1632883_at:137:425; Interrogation_Position=1226; Antisense; GAGACATCAACATAGCCTTCTTTCG
>probe:Drosophila_2:1632883_at:18:567; Interrogation_Position=1299; Antisense; GGCAAGCACATCTTCAGGACAAAGG
>probe:Drosophila_2:1632883_at:637:535; Interrogation_Position=1323; Antisense; GGTCGATCAGATCATCTCCAACTAT
>probe:Drosophila_2:1632883_at:356:419; Interrogation_Position=1390; Antisense; GAGCATGCATCATCTACGCGTAGTA
>probe:Drosophila_2:1632883_at:127:281; Interrogation_Position=868; Antisense; CCCATTTTGTGGATAGGCGAACGCA
>probe:Drosophila_2:1632883_at:269:47; Interrogation_Position=910; Antisense; ATCCGCATTGCCGAGATTGAGCTGG
>probe:Drosophila_2:1632883_at:110:291; Interrogation_Position=948; Antisense; CGGTTCGCAGCTCAGCTTTATAGAT
>probe:Drosophila_2:1632883_at:289:601; Interrogation_Position=972; Antisense; TGTATCGCACGGCATCATGGGCCAT

Paste this into a BLAST search page for me
TACAACACGCTTCTTAGTCTCGACTCCGCTTCTCAAACTTCTCGGAAAAGGTTCGATCCGTACCATATAATCAGGAGGTGAGCTTCAGATGCGTACAATGTAAGGTTCATGAGCGGGTCACACACGGTCACACACCATCAGATCTGCAAGGAGACATCAACATAGCCTTCTTTCGGGCAAGCACATCTTCAGGACAAAGGGGTCGATCAGATCATCTCCAACTATGAGCATGCATCATCTACGCGTAGTACCCATTTTGTGGATAGGCGAACGCAATCCGCATTGCCGAGATTGAGCTGGCGGTTCGCAGCTCAGCTTTATAGATTGTATCGCACGGCATCATGGGCCAT

Full Affymetrix probeset data:

Annotations for 1632883_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720