FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632884_at:

>probe:Drosophila_2:1632884_at:541:27; Interrogation_Position=3094; Antisense; ATACCCCGCACGAGTTTGGACTTGG
>probe:Drosophila_2:1632884_at:373:691; Interrogation_Position=3108; Antisense; TTTGGACTTGGAGCTGGACCTGCAG
>probe:Drosophila_2:1632884_at:383:255; Interrogation_Position=3144; Antisense; CAAACTCTACTTCCTCAATGATCAA
>probe:Drosophila_2:1632884_at:368:239; Interrogation_Position=3217; Antisense; AATAAGGATCCCTTGGTGGCCGCCT
>probe:Drosophila_2:1632884_at:611:575; Interrogation_Position=3234; Antisense; GGCCGCCTGGGCTATTGAAAACGAG
>probe:Drosophila_2:1632884_at:85:375; Interrogation_Position=3321; Antisense; GAAGTTGCTGATGAAGACCGCCAAA
>probe:Drosophila_2:1632884_at:68:169; Interrogation_Position=3379; Antisense; AAAGGCTGTCCCGATTTGGTGTCGT
>probe:Drosophila_2:1632884_at:472:109; Interrogation_Position=3410; Antisense; AGAAGATCACTTTCTTCACGCGCAA
>probe:Drosophila_2:1632884_at:56:95; Interrogation_Position=3452; Antisense; AGTTGCCCAGTGAATTTACCTTGCC
>probe:Drosophila_2:1632884_at:645:721; Interrogation_Position=3472; Antisense; TTGCCGGAAGCTAATCCCATCGAAG
>probe:Drosophila_2:1632884_at:163:11; Interrogation_Position=3533; Antisense; ATTCAGCTGAGACGGCAATTGCCAT
>probe:Drosophila_2:1632884_at:517:247; Interrogation_Position=3549; Antisense; AATTGCCATCAACACGGCGCTGGTG
>probe:Drosophila_2:1632884_at:52:593; Interrogation_Position=3569; Antisense; TGGTGGCTAGCAGCAACCGCAATAA
>probe:Drosophila_2:1632884_at:294:403; Interrogation_Position=3634; Antisense; GACTATGTGGTGGATCGCAACTACG

Paste this into a BLAST search page for me
ATACCCCGCACGAGTTTGGACTTGGTTTGGACTTGGAGCTGGACCTGCAGCAAACTCTACTTCCTCAATGATCAAAATAAGGATCCCTTGGTGGCCGCCTGGCCGCCTGGGCTATTGAAAACGAGGAAGTTGCTGATGAAGACCGCCAAAAAAGGCTGTCCCGATTTGGTGTCGTAGAAGATCACTTTCTTCACGCGCAAAGTTGCCCAGTGAATTTACCTTGCCTTGCCGGAAGCTAATCCCATCGAAGATTCAGCTGAGACGGCAATTGCCATAATTGCCATCAACACGGCGCTGGTGTGGTGGCTAGCAGCAACCGCAATAAGACTATGTGGTGGATCGCAACTACG

Full Affymetrix probeset data:

Annotations for 1632884_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720