FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632885_at:

>probe:Drosophila_2:1632885_at:664:5; Interrogation_Position=1297; Antisense; ATTGACTTCTATTTCCATGCGGGAG
>probe:Drosophila_2:1632885_at:306:417; Interrogation_Position=1319; Antisense; GAGAGTCCCGATGTCCGGATAGTTC
>probe:Drosophila_2:1632885_at:332:615; Interrogation_Position=1406; Antisense; TGAATCTACCCTTTCATCCAGAGAT
>probe:Drosophila_2:1632885_at:404:27; Interrogation_Position=1456; Antisense; ATAGCCGTGGAGATCTGTCCGCTGT
>probe:Drosophila_2:1632885_at:714:333; Interrogation_Position=1476; Antisense; GCTGTCCAACCATTATCTGCAATAC
>probe:Drosophila_2:1632885_at:656:655; Interrogation_Position=1503; Antisense; TAACGATTTTCGTCAACATCCGGCG
>probe:Drosophila_2:1632885_at:710:151; Interrogation_Position=1518; Antisense; ACATCCGGCGGCGTATTTGATTGCC
>probe:Drosophila_2:1632885_at:218:9; Interrogation_Position=1537; Antisense; ATTGCCGCCGGATTTCCAATTGTAA
>probe:Drosophila_2:1632885_at:242:557; Interrogation_Position=1569; Antisense; GGACTATCCGTGTTTCTGGAACTCC
>probe:Drosophila_2:1632885_at:457:607; Interrogation_Position=1601; Antisense; TGACCGACGACTTTTATGTGGCCTT
>probe:Drosophila_2:1632885_at:245:459; Interrogation_Position=1651; Antisense; GATTTGCGCCTCCTAAAGCAGTTTG
>probe:Drosophila_2:1632885_at:395:209; Interrogation_Position=1666; Antisense; AAGCAGTTTGCCCTCAATTCGTTTC
>probe:Drosophila_2:1632885_at:123:247; Interrogation_Position=1681; Antisense; AATTCGTTTCTGTTTAGCTCCCTCA
>probe:Drosophila_2:1632885_at:434:267; Interrogation_Position=1741; Antisense; CAGTGCAGCTGGAACCGATGGGTCA

Paste this into a BLAST search page for me
ATTGACTTCTATTTCCATGCGGGAGGAGAGTCCCGATGTCCGGATAGTTCTGAATCTACCCTTTCATCCAGAGATATAGCCGTGGAGATCTGTCCGCTGTGCTGTCCAACCATTATCTGCAATACTAACGATTTTCGTCAACATCCGGCGACATCCGGCGGCGTATTTGATTGCCATTGCCGCCGGATTTCCAATTGTAAGGACTATCCGTGTTTCTGGAACTCCTGACCGACGACTTTTATGTGGCCTTGATTTGCGCCTCCTAAAGCAGTTTGAAGCAGTTTGCCCTCAATTCGTTTCAATTCGTTTCTGTTTAGCTCCCTCACAGTGCAGCTGGAACCGATGGGTCA

Full Affymetrix probeset data:

Annotations for 1632885_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720