FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632886_at:

>probe:Drosophila_2:1632886_at:478:215; Interrogation_Position=446; Antisense; AAGTTGCTCCAGACTTCGGACTTAA
>probe:Drosophila_2:1632886_at:82:189; Interrogation_Position=623; Antisense; AAGCACCTAAATTGGCCACTGTCAG
>probe:Drosophila_2:1632886_at:466:495; Interrogation_Position=643; Antisense; GTCAGTAGTCCGATATTCAGCTTTA
>probe:Drosophila_2:1632886_at:500:223; Interrogation_Position=668; Antisense; AAGGCAAGTCCCTGCAACTAAAGTG
>probe:Drosophila_2:1632886_at:625:355; Interrogation_Position=692; Antisense; GCACTTTCCATCACATGAATCGCGA
>probe:Drosophila_2:1632886_at:468:367; Interrogation_Position=708; Antisense; GAATCGCGAACTGCTGAACCTGCAA
>probe:Drosophila_2:1632886_at:120:381; Interrogation_Position=723; Antisense; GAACCTGCAACTGGGATACGGCGTC
>probe:Drosophila_2:1632886_at:248:413; Interrogation_Position=825; Antisense; GACCGAAGATATCCAGCTGAAGCAC
>probe:Drosophila_2:1632886_at:392:545; Interrogation_Position=864; Antisense; GGATCAAAGTCACACCCAACGAAGA
>probe:Drosophila_2:1632886_at:72:199; Interrogation_Position=888; Antisense; AACGCAAGATCTCAGTTCACAGGTG
>probe:Drosophila_2:1632886_at:153:387; Interrogation_Position=915; Antisense; GAACAAGCTGGACACGGGTTTCTCT
>probe:Drosophila_2:1632886_at:52:531; Interrogation_Position=930; Antisense; GGGTTTCTCTATCCCAAACAGTGTG
>probe:Drosophila_2:1632886_at:1:181; Interrogation_Position=945; Antisense; AAACAGTGTGCTCCTCGGTAGCTCT
>probe:Drosophila_2:1632886_at:313:351; Interrogation_Position=978; Antisense; GCAGAACGCGCTGTTGATCCAAATT

Paste this into a BLAST search page for me
AAGTTGCTCCAGACTTCGGACTTAAAAGCACCTAAATTGGCCACTGTCAGGTCAGTAGTCCGATATTCAGCTTTAAAGGCAAGTCCCTGCAACTAAAGTGGCACTTTCCATCACATGAATCGCGAGAATCGCGAACTGCTGAACCTGCAAGAACCTGCAACTGGGATACGGCGTCGACCGAAGATATCCAGCTGAAGCACGGATCAAAGTCACACCCAACGAAGAAACGCAAGATCTCAGTTCACAGGTGGAACAAGCTGGACACGGGTTTCTCTGGGTTTCTCTATCCCAAACAGTGTGAAACAGTGTGCTCCTCGGTAGCTCTGCAGAACGCGCTGTTGATCCAAATT

Full Affymetrix probeset data:

Annotations for 1632886_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720