Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632889_at:

>probe:Drosophila_2:1632889_at:488:707; Interrogation_Position=1684; Antisense; TTCAACTTCAAGTACAGGCTATAGA
>probe:Drosophila_2:1632889_at:152:553; Interrogation_Position=1848; Antisense; GGAGAATTTTACTTTTGGCTGCATC
>probe:Drosophila_2:1632889_at:320:149; Interrogation_Position=1858; Antisense; ACTTTTGGCTGCATCTGAATGGTTA
>probe:Drosophila_2:1632889_at:391:601; Interrogation_Position=1929; Antisense; TGTTTCGTTTCGTTCTTGTAATGTA
>probe:Drosophila_2:1632889_at:331:217; Interrogation_Position=1970; Antisense; AAGTATTGTATTACCCCACGTGCAG
>probe:Drosophila_2:1632889_at:60:483; Interrogation_Position=1977; Antisense; GTATTACCCCACGTGCAGAGGAATG
>probe:Drosophila_2:1632889_at:302:363; Interrogation_Position=2011; Antisense; GAATTTAGGATACAATCGGCTGAGA
>probe:Drosophila_2:1632889_at:490:389; Interrogation_Position=2134; Antisense; GAAAAAGCTCTCTACAATGTTACAT
>probe:Drosophila_2:1632889_at:7:461; Interrogation_Position=2165; Antisense; GATTATTCTGACGTTTTACAAGTGT
>probe:Drosophila_2:1632889_at:605:477; Interrogation_Position=2188; Antisense; GTTTTTCGATTCACATTTCAATGGC
>probe:Drosophila_2:1632889_at:102:541; Interrogation_Position=2210; Antisense; GGCTTATTTTCCATTTCCGATTCCT
>probe:Drosophila_2:1632889_at:244:635; Interrogation_Position=2217; Antisense; TTTCCATTTCCGATTCCTAGTTAAG
>probe:Drosophila_2:1632889_at:128:629; Interrogation_Position=2231; Antisense; TCCTAGTTAAGTTTGGGCTCTTCCA
>probe:Drosophila_2:1632889_at:669:523; Interrogation_Position=2245; Antisense; GGGCTCTTCCATAACTAAAATCTTT

Paste this into a BLAST search page for me
TTCAACTTCAAGTACAGGCTATAGAGGAGAATTTTACTTTTGGCTGCATCACTTTTGGCTGCATCTGAATGGTTATGTTTCGTTTCGTTCTTGTAATGTAAAGTATTGTATTACCCCACGTGCAGGTATTACCCCACGTGCAGAGGAATGGAATTTAGGATACAATCGGCTGAGAGAAAAAGCTCTCTACAATGTTACATGATTATTCTGACGTTTTACAAGTGTGTTTTTCGATTCACATTTCAATGGCGGCTTATTTTCCATTTCCGATTCCTTTTCCATTTCCGATTCCTAGTTAAGTCCTAGTTAAGTTTGGGCTCTTCCAGGGCTCTTCCATAACTAAAATCTTT

Full Affymetrix probeset data:

Annotations for 1632889_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime