FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632890_at:

>probe:Drosophila_2:1632890_at:258:571; Interrogation_Position=2259; Antisense; GGCTTCGCCATCAATTTCACAGGAA
>probe:Drosophila_2:1632890_at:466:711; Interrogation_Position=2274; Antisense; TTCACAGGAATCATCGTCTTCACCA
>probe:Drosophila_2:1632890_at:539:135; Interrogation_Position=2305; Antisense; ACGCACTGCATCGTCAGGGATTCTA
>probe:Drosophila_2:1632890_at:29:497; Interrogation_Position=2317; Antisense; GTCAGGGATTCTACGCAGTCCGAAC
>probe:Drosophila_2:1632890_at:303:201; Interrogation_Position=2339; Antisense; AACCCGAGGCGGACAACCAGAAGCT
>probe:Drosophila_2:1632890_at:566:207; Interrogation_Position=2368; Antisense; AAGCTGAAGATCACACGGCTGCAGA
>probe:Drosophila_2:1632890_at:125:573; Interrogation_Position=2384; Antisense; GGCTGCAGACCAAGCGAACACTGAT
>probe:Drosophila_2:1632890_at:101:695; Interrogation_Position=2408; Antisense; TTCAAACCAAAGAGGCGGCGGCCGA
>probe:Drosophila_2:1632890_at:654:293; Interrogation_Position=2430; Antisense; CGAGTGTAGTCGACCGCTGCGCAAG
>probe:Drosophila_2:1632890_at:69:441; Interrogation_Position=2518; Antisense; GATGGCGAACAGAGCAACGGCAGTA
>probe:Drosophila_2:1632890_at:665:51; Interrogation_Position=2558; Antisense; ATGCGGATCCGGAAGCAGAGTGCAA
>probe:Drosophila_2:1632890_at:347:433; Interrogation_Position=2575; Antisense; GAGTGCAATATGAGCGGCAGCCACA
>probe:Drosophila_2:1632890_at:24:403; Interrogation_Position=2631; Antisense; GACATAGACCTTAGGATTTACCCCT
>probe:Drosophila_2:1632890_at:307:219; Interrogation_Position=2767; Antisense; AAGTGCATGCGGTACTCAGTTTTGA

Paste this into a BLAST search page for me
GGCTTCGCCATCAATTTCACAGGAATTCACAGGAATCATCGTCTTCACCAACGCACTGCATCGTCAGGGATTCTAGTCAGGGATTCTACGCAGTCCGAACAACCCGAGGCGGACAACCAGAAGCTAAGCTGAAGATCACACGGCTGCAGAGGCTGCAGACCAAGCGAACACTGATTTCAAACCAAAGAGGCGGCGGCCGACGAGTGTAGTCGACCGCTGCGCAAGGATGGCGAACAGAGCAACGGCAGTAATGCGGATCCGGAAGCAGAGTGCAAGAGTGCAATATGAGCGGCAGCCACAGACATAGACCTTAGGATTTACCCCTAAGTGCATGCGGTACTCAGTTTTGA

Full Affymetrix probeset data:

Annotations for 1632890_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720