FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632894_at:

>probe:Drosophila_2:1632894_at:189:573; Interrogation_Position=2406; Antisense; GGCGGAATCACCATCATCGAGGGCA
>probe:Drosophila_2:1632894_at:728:443; Interrogation_Position=2433; Antisense; GATGATGAGCGCGAGAACCTGATTG
>probe:Drosophila_2:1632894_at:47:315; Interrogation_Position=2473; Antisense; GCCATGAGTACGATTAGGCCCCATA
>probe:Drosophila_2:1632894_at:232:725; Interrogation_Position=2509; Antisense; TTGATCTGCATCACCAATATTCCCT
>probe:Drosophila_2:1632894_at:465:243; Interrogation_Position=2524; Antisense; AATATTCCCTGCATTAGTCCGTAGT
>probe:Drosophila_2:1632894_at:678:7; Interrogation_Position=2536; Antisense; ATTAGTCCGTAGTCTATAGTCCCCG
>probe:Drosophila_2:1632894_at:465:653; Interrogation_Position=2550; Antisense; TATAGTCCCCGGAGTCTTGGATATA
>probe:Drosophila_2:1632894_at:94:163; Interrogation_Position=2582; Antisense; AAATTCTGAGCTAGTACTTTACCAT
>probe:Drosophila_2:1632894_at:194:21; Interrogation_Position=2618; Antisense; ATTTGTTTTATGTTCAGCGCATCTT
>probe:Drosophila_2:1632894_at:363:183; Interrogation_Position=2665; Antisense; AAAAGCAAACGCGATGGCCATGGAG
>probe:Drosophila_2:1632894_at:53:727; Interrogation_Position=2712; Antisense; TTGTATAGGGCAACGTCGGCACAAC
>probe:Drosophila_2:1632894_at:625:637; Interrogation_Position=2727; Antisense; TCGGCACAACGTTTGGTGGGCACCA
>probe:Drosophila_2:1632894_at:527:365; Interrogation_Position=2835; Antisense; GAATACTGAACGCTTGTGACACCCA
>probe:Drosophila_2:1632894_at:712:307; Interrogation_Position=2857; Antisense; CCAGGCCCTATCCTTGGTTTAAGAT

Paste this into a BLAST search page for me
GGCGGAATCACCATCATCGAGGGCAGATGATGAGCGCGAGAACCTGATTGGCCATGAGTACGATTAGGCCCCATATTGATCTGCATCACCAATATTCCCTAATATTCCCTGCATTAGTCCGTAGTATTAGTCCGTAGTCTATAGTCCCCGTATAGTCCCCGGAGTCTTGGATATAAAATTCTGAGCTAGTACTTTACCATATTTGTTTTATGTTCAGCGCATCTTAAAAGCAAACGCGATGGCCATGGAGTTGTATAGGGCAACGTCGGCACAACTCGGCACAACGTTTGGTGGGCACCAGAATACTGAACGCTTGTGACACCCACCAGGCCCTATCCTTGGTTTAAGAT

Full Affymetrix probeset data:

Annotations for 1632894_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720