FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632895_at:

>probe:Drosophila_2:1632895_at:566:365; Interrogation_Position=4799; Antisense; GAATCCTTCAGGACTTTCAGGACTT
>probe:Drosophila_2:1632895_at:372:233; Interrogation_Position=4838; Antisense; AATGCGGCGACAGACAGCTGCCTGC
>probe:Drosophila_2:1632895_at:629:85; Interrogation_Position=4865; Antisense; AGTCCCCTCCAGTATTTGTCCGGAT
>probe:Drosophila_2:1632895_at:606:631; Interrogation_Position=4898; Antisense; TCCGGTTTCCTCTGGTCTGAAATTT
>probe:Drosophila_2:1632895_at:491:703; Interrogation_Position=4966; Antisense; TTATCTTTGACTTGGCGGCATAGCC
>probe:Drosophila_2:1632895_at:24:85; Interrogation_Position=4992; Antisense; AGTGGTTAGAGCTCGACTGCTGGCC
>probe:Drosophila_2:1632895_at:367:579; Interrogation_Position=5013; Antisense; GGCCTTCTGGCTTTGTGTGAGCAAA
>probe:Drosophila_2:1632895_at:722:713; Interrogation_Position=5040; Antisense; TTCTGCCGGCGTAAATTAGTTAAGA
>probe:Drosophila_2:1632895_at:370:159; Interrogation_Position=5065; Antisense; AAATTGCAGTGGAGGTTTCCCTGGA
>probe:Drosophila_2:1632895_at:563:717; Interrogation_Position=5081; Antisense; TTCCCTGGAGATTGCAGCGAAGGTT
>probe:Drosophila_2:1632895_at:715:371; Interrogation_Position=5099; Antisense; GAAGGTTCGCCGTATCGATATAAGC
>probe:Drosophila_2:1632895_at:277:681; Interrogation_Position=5117; Antisense; TATAAGCAGCGATTCCCGTAAGGGA
>probe:Drosophila_2:1632895_at:203:7; Interrogation_Position=5161; Antisense; ATTGCACAGCTAAGTCGCTTCAGCA
>probe:Drosophila_2:1632895_at:387:229; Interrogation_Position=5333; Antisense; AATGGAGTGCGATTAGCTTGATAGT

Paste this into a BLAST search page for me
GAATCCTTCAGGACTTTCAGGACTTAATGCGGCGACAGACAGCTGCCTGCAGTCCCCTCCAGTATTTGTCCGGATTCCGGTTTCCTCTGGTCTGAAATTTTTATCTTTGACTTGGCGGCATAGCCAGTGGTTAGAGCTCGACTGCTGGCCGGCCTTCTGGCTTTGTGTGAGCAAATTCTGCCGGCGTAAATTAGTTAAGAAAATTGCAGTGGAGGTTTCCCTGGATTCCCTGGAGATTGCAGCGAAGGTTGAAGGTTCGCCGTATCGATATAAGCTATAAGCAGCGATTCCCGTAAGGGAATTGCACAGCTAAGTCGCTTCAGCAAATGGAGTGCGATTAGCTTGATAGT

Full Affymetrix probeset data:

Annotations for 1632895_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720