Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632896_at:

>probe:Drosophila_2:1632896_at:69:459; Interrogation_Position=1463; Antisense; GATTTAAGTTTTCTAGCATTCCAAA
>probe:Drosophila_2:1632896_at:196:27; Interrogation_Position=1526; Antisense; ATAGCTCTATATTCTTTAAAACGTA
>probe:Drosophila_2:1632896_at:487:493; Interrogation_Position=1548; Antisense; GTAATACATTTGACATTTGCTTGAT
>probe:Drosophila_2:1632896_at:116:695; Interrogation_Position=1563; Antisense; TTTGCTTGATTGTTTGATGCCCTAG
>probe:Drosophila_2:1632896_at:183:481; Interrogation_Position=1574; Antisense; GTTTGATGCCCTAGCTGAGGAACAT
>probe:Drosophila_2:1632896_at:583:561; Interrogation_Position=1592; Antisense; GGAACATCTGGCAGTGCTCGCACAG
>probe:Drosophila_2:1632896_at:662:125; Interrogation_Position=1620; Antisense; AGCCTCCTCTTCTTCAATTCGATTA
>probe:Drosophila_2:1632896_at:28:277; Interrogation_Position=1628; Antisense; CTTCTTCAATTCGATTACCACTGGA
>probe:Drosophila_2:1632896_at:635:443; Interrogation_Position=1658; Antisense; GATGATGGTCGATTGATTTTTAAAC
>probe:Drosophila_2:1632896_at:133:447; Interrogation_Position=1702; Antisense; GATGCTTCTTCCTTCTGGGACTTAA
>probe:Drosophila_2:1632896_at:671:719; Interrogation_Position=1710; Antisense; TTCCTTCTGGGACTTAACTCACAAT
>probe:Drosophila_2:1632896_at:141:255; Interrogation_Position=1729; Antisense; CACAATAAAGTCACGCAGTTGCGGC
>probe:Drosophila_2:1632896_at:553:357; Interrogation_Position=1752; Antisense; GCAAATAAACTTGGCGCACTCGCCG
>probe:Drosophila_2:1632896_at:113:431; Interrogation_Position=1780; Antisense; GAGTAGCCACACTCCTCGCAGAGAT

Paste this into a BLAST search page for me
GATTTAAGTTTTCTAGCATTCCAAAATAGCTCTATATTCTTTAAAACGTAGTAATACATTTGACATTTGCTTGATTTTGCTTGATTGTTTGATGCCCTAGGTTTGATGCCCTAGCTGAGGAACATGGAACATCTGGCAGTGCTCGCACAGAGCCTCCTCTTCTTCAATTCGATTACTTCTTCAATTCGATTACCACTGGAGATGATGGTCGATTGATTTTTAAACGATGCTTCTTCCTTCTGGGACTTAATTCCTTCTGGGACTTAACTCACAATCACAATAAAGTCACGCAGTTGCGGCGCAAATAAACTTGGCGCACTCGCCGGAGTAGCCACACTCCTCGCAGAGAT

Full Affymetrix probeset data:

Annotations for 1632896_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime