Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632897_at:

>probe:Drosophila_2:1632897_at:214:569; Interrogation_Position=1214; Antisense; GGCTTTAACCCAATCACTGGTCGAA
>probe:Drosophila_2:1632897_at:487:139; Interrogation_Position=1229; Antisense; ACTGGTCGAACGTCAAAGTCTTCTG
>probe:Drosophila_2:1632897_at:359:99; Interrogation_Position=1270; Antisense; AGAGAAATGCCCTGCGACTACAGCA
>probe:Drosophila_2:1632897_at:120:227; Interrogation_Position=1299; Antisense; AAGGCACAGACGCAGCTACAGCAAA
>probe:Drosophila_2:1632897_at:199:441; Interrogation_Position=1392; Antisense; GATGTCAAAGCACAATTCCCGCTTC
>probe:Drosophila_2:1632897_at:658:713; Interrogation_Position=1414; Antisense; TTCTCATGCATCCAAGTCCATTCGA
>probe:Drosophila_2:1632897_at:505:639; Interrogation_Position=1442; Antisense; TCGTGTGGCACGACGCTTCAAGCGA
>probe:Drosophila_2:1632897_at:619:517; Interrogation_Position=1500; Antisense; GTGGGAACGTTTCTGCGTCGCTATC
>probe:Drosophila_2:1632897_at:615:445; Interrogation_Position=1529; Antisense; GATGCGGGTCTCTGTGATCGTCTAC
>probe:Drosophila_2:1632897_at:269:669; Interrogation_Position=1551; Antisense; TACGTGGCCCTACTACATCTGTGGG
>probe:Drosophila_2:1632897_at:604:271; Interrogation_Position=1566; Antisense; CATCTGTGGGTCATGTTTGTGCTGC
>probe:Drosophila_2:1632897_at:285:485; Interrogation_Position=1659; Antisense; GTATGTATTGTATTTTACGCGCCAA
>probe:Drosophila_2:1632897_at:271:687; Interrogation_Position=1749; Antisense; TATTATACTTGTGTCTCGCACTCGT
>probe:Drosophila_2:1632897_at:498:499; Interrogation_Position=1761; Antisense; GTCTCGCACTCGTTCTAAATTCAAT

Paste this into a BLAST search page for me
GGCTTTAACCCAATCACTGGTCGAAACTGGTCGAACGTCAAAGTCTTCTGAGAGAAATGCCCTGCGACTACAGCAAAGGCACAGACGCAGCTACAGCAAAGATGTCAAAGCACAATTCCCGCTTCTTCTCATGCATCCAAGTCCATTCGATCGTGTGGCACGACGCTTCAAGCGAGTGGGAACGTTTCTGCGTCGCTATCGATGCGGGTCTCTGTGATCGTCTACTACGTGGCCCTACTACATCTGTGGGCATCTGTGGGTCATGTTTGTGCTGCGTATGTATTGTATTTTACGCGCCAATATTATACTTGTGTCTCGCACTCGTGTCTCGCACTCGTTCTAAATTCAAT

Full Affymetrix probeset data:

Annotations for 1632897_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime