FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632898_at:

>probe:Drosophila_2:1632898_at:427:695; Interrogation_Position=1507; Antisense; TTTCGACGCCAACCAGCTAGTGGAA
>probe:Drosophila_2:1632898_at:372:117; Interrogation_Position=1521; Antisense; AGCTAGTGGAAATTCAAGGCGCCCA
>probe:Drosophila_2:1632898_at:714:389; Interrogation_Position=1601; Antisense; GAAACTTAAACTTACCTGCTCATCC
>probe:Drosophila_2:1632898_at:443:155; Interrogation_Position=1644; Antisense; ACAGCAAAACGTCCCATCTACTATA
>probe:Drosophila_2:1632898_at:137:33; Interrogation_Position=1666; Antisense; ATAATTCCCACATCTGTTGAGCCTA
>probe:Drosophila_2:1632898_at:617:277; Interrogation_Position=1688; Antisense; CTATAACTGAGTATCGCACGCACAC
>probe:Drosophila_2:1632898_at:5:355; Interrogation_Position=1703; Antisense; GCACGCACACTTCTACATATGTTAC
>probe:Drosophila_2:1632898_at:473:55; Interrogation_Position=1721; Antisense; ATGTTACTACAATATTCGACGGAAA
>probe:Drosophila_2:1632898_at:589:393; Interrogation_Position=1742; Antisense; GAAAGTCTACCATTCTTCCAGTGAC
>probe:Drosophila_2:1632898_at:80:147; Interrogation_Position=1789; Antisense; ACTACTGTTTATGACACTACCGCTC
>probe:Drosophila_2:1632898_at:160:399; Interrogation_Position=1801; Antisense; GACACTACCGCTCAGACTATAACAG
>probe:Drosophila_2:1632898_at:46:663; Interrogation_Position=1854; Antisense; TAACACTCTACCGTCAGTTCAAAGT
>probe:Drosophila_2:1632898_at:534:513; Interrogation_Position=1877; Antisense; GTGTACATACTGTTGGACCGGCTGC
>probe:Drosophila_2:1632898_at:424:555; Interrogation_Position=1891; Antisense; GGACCGGCTGCTCATGTAAATAATT

Paste this into a BLAST search page for me
TTTCGACGCCAACCAGCTAGTGGAAAGCTAGTGGAAATTCAAGGCGCCCAGAAACTTAAACTTACCTGCTCATCCACAGCAAAACGTCCCATCTACTATAATAATTCCCACATCTGTTGAGCCTACTATAACTGAGTATCGCACGCACACGCACGCACACTTCTACATATGTTACATGTTACTACAATATTCGACGGAAAGAAAGTCTACCATTCTTCCAGTGACACTACTGTTTATGACACTACCGCTCGACACTACCGCTCAGACTATAACAGTAACACTCTACCGTCAGTTCAAAGTGTGTACATACTGTTGGACCGGCTGCGGACCGGCTGCTCATGTAAATAATT

Full Affymetrix probeset data:

Annotations for 1632898_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720