Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632904_at:

>probe:Drosophila_2:1632904_at:323:193; Interrogation_Position=2762; Antisense; AACTACCAGCAACAAGGCGGCAGCA
>probe:Drosophila_2:1632904_at:16:569; Interrogation_Position=2780; Antisense; GGCAGCAGGCAACAGAATCAGAATT
>probe:Drosophila_2:1632904_at:125:105; Interrogation_Position=2807; Antisense; AGACGGTTTTAGGTGTATCATACAA
>probe:Drosophila_2:1632904_at:657:543; Interrogation_Position=2914; Antisense; GGATTTCCAAACAAACTCATGCCAA
>probe:Drosophila_2:1632904_at:295:271; Interrogation_Position=2931; Antisense; CATGCCAAGTTCTGAGTTTGTTCTT
>probe:Drosophila_2:1632904_at:600:241; Interrogation_Position=2963; Antisense; AATACCCATTGCATTTCTATCAAAG
>probe:Drosophila_2:1632904_at:326:345; Interrogation_Position=2973; Antisense; GCATTTCTATCAAAGCAGCTTACAG
>probe:Drosophila_2:1632904_at:126:353; Interrogation_Position=2987; Antisense; GCAGCTTACAGCCAACATCTAGTCT
>probe:Drosophila_2:1632904_at:102:191; Interrogation_Position=3000; Antisense; AACATCTAGTCTTAGTGCCTCAAAG
>probe:Drosophila_2:1632904_at:593:231; Interrogation_Position=3045; Antisense; AATGATCATTTCTCTTTCCATTGAT
>probe:Drosophila_2:1632904_at:598:711; Interrogation_Position=3054; Antisense; TTCTCTTTCCATTGATTGCGTAAAA
>probe:Drosophila_2:1632904_at:67:691; Interrogation_Position=3228; Antisense; TTTGTTTTAAATCCGGAGTCATAAT
>probe:Drosophila_2:1632904_at:409:477; Interrogation_Position=3263; Antisense; GTTTTTATGGAATAGCATTCGCTAT
>probe:Drosophila_2:1632904_at:499:689; Interrogation_Position=3306; Antisense; TATTATTTCGATTTCCATGTAACAT

Paste this into a BLAST search page for me
AACTACCAGCAACAAGGCGGCAGCAGGCAGCAGGCAACAGAATCAGAATTAGACGGTTTTAGGTGTATCATACAAGGATTTCCAAACAAACTCATGCCAACATGCCAAGTTCTGAGTTTGTTCTTAATACCCATTGCATTTCTATCAAAGGCATTTCTATCAAAGCAGCTTACAGGCAGCTTACAGCCAACATCTAGTCTAACATCTAGTCTTAGTGCCTCAAAGAATGATCATTTCTCTTTCCATTGATTTCTCTTTCCATTGATTGCGTAAAATTTGTTTTAAATCCGGAGTCATAATGTTTTTATGGAATAGCATTCGCTATTATTATTTCGATTTCCATGTAACAT

Full Affymetrix probeset data:

Annotations for 1632904_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime