FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632910_at:

>probe:Drosophila_2:1632910_at:245:397; Interrogation_Position=1003; Antisense; GACAAGACCCGCTTTGTGCAACATA
>probe:Drosophila_2:1632910_at:534:729; Interrogation_Position=1016; Antisense; TTGTGCAACATACGGCGCGTCATGA
>probe:Drosophila_2:1632910_at:11:59; Interrogation_Position=1064; Antisense; ATGATTTTCGCCAATTCCGAGCCAA
>probe:Drosophila_2:1632910_at:487:119; Interrogation_Position=1108; Antisense; AGCTGCGGTTATGCCACTGCAAGTG
>probe:Drosophila_2:1632910_at:439:97; Interrogation_Position=1167; Antisense; AGATCCCACAGAGGCGGTAACGGCA
>probe:Drosophila_2:1632910_at:573:279; Interrogation_Position=1183; Antisense; GTAACGGCATCCTCGCGGAAAACTT
>probe:Drosophila_2:1632910_at:579:533; Interrogation_Position=1257; Antisense; GGTGGTGGCCCATCGAAGATTGCAT
>probe:Drosophila_2:1632910_at:64:215; Interrogation_Position=1272; Antisense; AAGATTGCATCTTCGCCAGGACTAT
>probe:Drosophila_2:1632910_at:525:557; Interrogation_Position=1290; Antisense; GGACTATGTGCGGAATGCTGGCTTC
>probe:Drosophila_2:1632910_at:537:389; Interrogation_Position=1328; Antisense; GAAACGAGCAGTGCGATTCTCCCGG
>probe:Drosophila_2:1632910_at:72:551; Interrogation_Position=1405; Antisense; GGAGTCCTTTCACGAGCACAACTGG
>probe:Drosophila_2:1632910_at:414:433; Interrogation_Position=888; Antisense; GAGTGGCTATCTAAAATTCCGCTTC
>probe:Drosophila_2:1632910_at:413:9; Interrogation_Position=903; Antisense; ATTCCGCTTCAACGAGGACTGTGGA
>probe:Drosophila_2:1632910_at:136:465; Interrogation_Position=982; Antisense; GATTGCCACTATAGTTTCTGCGACA

Paste this into a BLAST search page for me
GACAAGACCCGCTTTGTGCAACATATTGTGCAACATACGGCGCGTCATGAATGATTTTCGCCAATTCCGAGCCAAAGCTGCGGTTATGCCACTGCAAGTGAGATCCCACAGAGGCGGTAACGGCAGTAACGGCATCCTCGCGGAAAACTTGGTGGTGGCCCATCGAAGATTGCATAAGATTGCATCTTCGCCAGGACTATGGACTATGTGCGGAATGCTGGCTTCGAAACGAGCAGTGCGATTCTCCCGGGGAGTCCTTTCACGAGCACAACTGGGAGTGGCTATCTAAAATTCCGCTTCATTCCGCTTCAACGAGGACTGTGGAGATTGCCACTATAGTTTCTGCGACA

Full Affymetrix probeset data:

Annotations for 1632910_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720