FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632911_at:

>probe:Drosophila_2:1632911_at:705:529; Interrogation_Position=105; Antisense; GGTTTCGGCGGAGCACGACGACAAC
>probe:Drosophila_2:1632911_at:402:51; Interrogation_Position=13; Antisense; ATGCGTGCGCTTCAGTACCTTCTGC
>probe:Drosophila_2:1632911_at:209:335; Interrogation_Position=148; Antisense; GCTCTGGAGGCCATCGCCGGGCTAT
>probe:Drosophila_2:1632911_at:665:409; Interrogation_Position=192; Antisense; GACGAAGATCGATGGCTCTGCCAGC
>probe:Drosophila_2:1632911_at:589:261; Interrogation_Position=213; Antisense; CAGCCTGGTGCATCGAACACATGGA
>probe:Drosophila_2:1632911_at:345:387; Interrogation_Position=236; Antisense; GAACACAATCGGGTACGGGCAGCAC
>probe:Drosophila_2:1632911_at:234:487; Interrogation_Position=248; Antisense; GTACGGGCAGCACCAGATACCAGGC
>probe:Drosophila_2:1632911_at:183:91; Interrogation_Position=26; Antisense; AGTACCTTCTGCTACTGCTCGTCAT
>probe:Drosophila_2:1632911_at:579:457; Interrogation_Position=263; Antisense; GATACCAGGCCAAACTGCATCTACA
>probe:Drosophila_2:1632911_at:82:195; Interrogation_Position=275; Antisense; AACTGCATCTACACCATGACTATAA
>probe:Drosophila_2:1632911_at:456:685; Interrogation_Position=295; Antisense; TATAAGACCAATGCGTATCCCTCGT
>probe:Drosophila_2:1632911_at:263:637; Interrogation_Position=44; Antisense; TCGTCATCTCCATCGGCTTGGCGGC
>probe:Drosophila_2:1632911_at:213:121; Interrogation_Position=83; Antisense; AGCGTCGTCAGATCGATCTCACGGT
>probe:Drosophila_2:1632911_at:3:99; Interrogation_Position=92; Antisense; AGATCGATCTCACGGTTTCGGCGGA

Paste this into a BLAST search page for me
GGTTTCGGCGGAGCACGACGACAACATGCGTGCGCTTCAGTACCTTCTGCGCTCTGGAGGCCATCGCCGGGCTATGACGAAGATCGATGGCTCTGCCAGCCAGCCTGGTGCATCGAACACATGGAGAACACAATCGGGTACGGGCAGCACGTACGGGCAGCACCAGATACCAGGCAGTACCTTCTGCTACTGCTCGTCATGATACCAGGCCAAACTGCATCTACAAACTGCATCTACACCATGACTATAATATAAGACCAATGCGTATCCCTCGTTCGTCATCTCCATCGGCTTGGCGGCAGCGTCGTCAGATCGATCTCACGGTAGATCGATCTCACGGTTTCGGCGGA

Full Affymetrix probeset data:

Annotations for 1632911_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720