FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632914_at:

>probe:Drosophila_2:1632914_at:441:83; Interrogation_Position=2071; Antisense; AGGGCCCATGTGACGCTCAGCGAAA
>probe:Drosophila_2:1632914_at:616:87; Interrogation_Position=2156; Antisense; AGTCAGAGTGCAGTCCCAGGATACA
>probe:Drosophila_2:1632914_at:684:103; Interrogation_Position=2194; Antisense; AGACGCATCTCCCATACGGACGGAG
>probe:Drosophila_2:1632914_at:656:319; Interrogation_Position=2277; Antisense; GCCCACTTCCAGTAGGCGAAACAGC
>probe:Drosophila_2:1632914_at:573:179; Interrogation_Position=2295; Antisense; AAACAGCGAGACGACGCTCCTGCGA
>probe:Drosophila_2:1632914_at:344:335; Interrogation_Position=2310; Antisense; GCTCCTGCGATTCTTTAGCATTCAG
>probe:Drosophila_2:1632914_at:108:273; Interrogation_Position=2328; Antisense; CATTCAGAGAAGTAGCAGTGTGCCG
>probe:Drosophila_2:1632914_at:92:597; Interrogation_Position=2346; Antisense; TGTGCCGGCGGAGGAAACAACGACA
>probe:Drosophila_2:1632914_at:709:159; Interrogation_Position=2362; Antisense; ACAACGACAACGAATGCGGCTCCCT
>probe:Drosophila_2:1632914_at:26:465; Interrogation_Position=2473; Antisense; GATTGACGCGGAGCCTCGAGCCACA
>probe:Drosophila_2:1632914_at:499:415; Interrogation_Position=2490; Antisense; GAGCCACAGCACCATTATTGCACTT
>probe:Drosophila_2:1632914_at:481:5; Interrogation_Position=2506; Antisense; ATTGCACTTGTAGTTTTAAGCGGAC
>probe:Drosophila_2:1632914_at:577:671; Interrogation_Position=2555; Antisense; TAGTAGGTTGCATCTATCGCGGGAC
>probe:Drosophila_2:1632914_at:130:467; Interrogation_Position=2569; Antisense; TATCGCGGGACGAGTTGGTAACCAA

Paste this into a BLAST search page for me
AGGGCCCATGTGACGCTCAGCGAAAAGTCAGAGTGCAGTCCCAGGATACAAGACGCATCTCCCATACGGACGGAGGCCCACTTCCAGTAGGCGAAACAGCAAACAGCGAGACGACGCTCCTGCGAGCTCCTGCGATTCTTTAGCATTCAGCATTCAGAGAAGTAGCAGTGTGCCGTGTGCCGGCGGAGGAAACAACGACAACAACGACAACGAATGCGGCTCCCTGATTGACGCGGAGCCTCGAGCCACAGAGCCACAGCACCATTATTGCACTTATTGCACTTGTAGTTTTAAGCGGACTAGTAGGTTGCATCTATCGCGGGACTATCGCGGGACGAGTTGGTAACCAA

Full Affymetrix probeset data:

Annotations for 1632914_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720